Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634770_at:

>probe:Drosophila_2:1634770_at:23:435; Interrogation_Position=27144; Antisense; GAGGTGATAACCATACGTTCCATTA
>probe:Drosophila_2:1634770_at:584:253; Interrogation_Position=27184; Antisense; CAAAAAGTTCTACCTCATCATCCTC
>probe:Drosophila_2:1634770_at:478:189; Interrogation_Position=27222; Antisense; AACAGTCGCAAGGTGCTAACCAGCG
>probe:Drosophila_2:1634770_at:265:397; Interrogation_Position=27273; Antisense; GACAAACCGCTCGAGGTGGTCTACC
>probe:Drosophila_2:1634770_at:574:589; Interrogation_Position=27289; Antisense; TGGTCTACCGACAGCCAGAGTTTGA
>probe:Drosophila_2:1634770_at:123:157; Interrogation_Position=27320; Antisense; ACACCACACGATCATGTCTGTGCGT
>probe:Drosophila_2:1634770_at:288:351; Interrogation_Position=27371; Antisense; GCAGAGGTGCATTAACGAGTTCGAT
>probe:Drosophila_2:1634770_at:624:441; Interrogation_Position=27393; Antisense; GATGTCAGTTTCATCGACACCACCG
>probe:Drosophila_2:1634770_at:476:707; Interrogation_Position=27444; Antisense; TTACCCATGTTAGGCTCCGGTGATC
>probe:Drosophila_2:1634770_at:630:87; Interrogation_Position=27516; Antisense; AGTCCCCTGGCCCTTATTGAGGAGA
>probe:Drosophila_2:1634770_at:608:257; Interrogation_Position=27588; Antisense; CACAGTAGCGGTGCTATTGCTGCTG
>probe:Drosophila_2:1634770_at:578:711; Interrogation_Position=27616; Antisense; TTGATCCTTCTCTGTCGATGCCAGT
>probe:Drosophila_2:1634770_at:580:573; Interrogation_Position=27640; Antisense; TGGCTTTTGGAGAGAGTCACCTGGA
>probe:Drosophila_2:1634770_at:158:223; Interrogation_Position=27684; Antisense; AAGGGCAGCATTTCCAAAGGTAACT

Paste this into a BLAST search page for me
GAGGTGATAACCATACGTTCCATTACAAAAAGTTCTACCTCATCATCCTCAACAGTCGCAAGGTGCTAACCAGCGGACAAACCGCTCGAGGTGGTCTACCTGGTCTACCGACAGCCAGAGTTTGAACACCACACGATCATGTCTGTGCGTGCAGAGGTGCATTAACGAGTTCGATGATGTCAGTTTCATCGACACCACCGTTACCCATGTTAGGCTCCGGTGATCAGTCCCCTGGCCCTTATTGAGGAGACACAGTAGCGGTGCTATTGCTGCTGTTGATCCTTCTCTGTCGATGCCAGTTGGCTTTTGGAGAGAGTCACCTGGAAAGGGCAGCATTTCCAAAGGTAACT

Full Affymetrix probeset data:

Annotations for 1634770_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime