FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634772_at:

>probe:Drosophila_2:1634772_at:24:413; Interrogation_Position=416; Antisense; GACCGCACACATGGATTCGATTCTT
>probe:Drosophila_2:1634772_at:515:433; Interrogation_Position=490; Antisense; GAGGCGGTTCAGTTTGGCCCACCAA
>probe:Drosophila_2:1634772_at:365:647; Interrogation_Position=525; Antisense; TCAGGCGCAGCAGATCCCATTAGAT
>probe:Drosophila_2:1634772_at:56:679; Interrogation_Position=545; Antisense; TAGATGCCGTTCAAACTTATCGCCC
>probe:Drosophila_2:1634772_at:33:705; Interrogation_Position=561; Antisense; TTATCGCCCTGCCATAGAACCTATA
>probe:Drosophila_2:1634772_at:584:25; Interrogation_Position=574; Antisense; ATAGAACCTATATCGCTGCGCTCTG
>probe:Drosophila_2:1634772_at:423:361; Interrogation_Position=636; Antisense; GAATCCGGAACTTCGCCATTTTCTG
>probe:Drosophila_2:1634772_at:650:717; Interrogation_Position=647; Antisense; TTCGCCATTTTCTGCCCAATAATAT
>probe:Drosophila_2:1634772_at:564:161; Interrogation_Position=714; Antisense; AAATTGACCGCTTGGCAGCTTCCAA
>probe:Drosophila_2:1634772_at:363:191; Interrogation_Position=737; Antisense; AACTATCGGGTCTCTCCTGGTAGAT
>probe:Drosophila_2:1634772_at:620:25; Interrogation_Position=781; Antisense; ATAGCATTTGCACCTTTTGAACAGT
>probe:Drosophila_2:1634772_at:570:205; Interrogation_Position=814; Antisense; AAGAGACTAGAACATTCCCCAACCT
>probe:Drosophila_2:1634772_at:175:631; Interrogation_Position=829; Antisense; TCCCCAACCTAATGTTTTCGCAGAT
>probe:Drosophila_2:1634772_at:384:433; Interrogation_Position=918; Antisense; GAGGGTAATATTCTCTCATACGAAG

Paste this into a BLAST search page for me
GACCGCACACATGGATTCGATTCTTGAGGCGGTTCAGTTTGGCCCACCAATCAGGCGCAGCAGATCCCATTAGATTAGATGCCGTTCAAACTTATCGCCCTTATCGCCCTGCCATAGAACCTATAATAGAACCTATATCGCTGCGCTCTGGAATCCGGAACTTCGCCATTTTCTGTTCGCCATTTTCTGCCCAATAATATAAATTGACCGCTTGGCAGCTTCCAAAACTATCGGGTCTCTCCTGGTAGATATAGCATTTGCACCTTTTGAACAGTAAGAGACTAGAACATTCCCCAACCTTCCCCAACCTAATGTTTTCGCAGATGAGGGTAATATTCTCTCATACGAAG

Full Affymetrix probeset data:

Annotations for 1634772_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720