FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634773_at:

>probe:Drosophila_2:1634773_at:306:307; Interrogation_Position=371; Antisense; CCATGTCCTGGTGGTGAGGCCCAAG
>probe:Drosophila_2:1634773_at:72:225; Interrogation_Position=393; Antisense; AAGGCCTTCGGCTACTTCAACTTCA
>probe:Drosophila_2:1634773_at:558:301; Interrogation_Position=424; Antisense; CCGAGGTGTCCTACAAGGCTGTCGA
>probe:Drosophila_2:1634773_at:392:551; Interrogation_Position=455; Antisense; GGAGACGCTCCAACTGGCGGTCAGC
>probe:Drosophila_2:1634773_at:456:565; Interrogation_Position=498; Antisense; GGAATTGTCAACCTGAACGAGTACA
>probe:Drosophila_2:1634773_at:223:17; Interrogation_Position=541; Antisense; ATTTCTTCGACTGGGTGGCCTTCGC
>probe:Drosophila_2:1634773_at:718:641; Interrogation_Position=602; Antisense; TCTGTGGCACCAGTCCAAGAGCAAA
>probe:Drosophila_2:1634773_at:291:147; Interrogation_Position=655; Antisense; ACTAAGCTGCAGGACGGACGGTTTC
>probe:Drosophila_2:1634773_at:198:635; Interrogation_Position=681; Antisense; TCGCCACCACCAAGAGATTTCTTTG
>probe:Drosophila_2:1634773_at:554:247; Interrogation_Position=751; Antisense; AATTGATTCCATGCGTTGTTCATCT
>probe:Drosophila_2:1634773_at:615:725; Interrogation_Position=766; Antisense; TTGTTCATCTATTCAACCCACACAT
>probe:Drosophila_2:1634773_at:673:151; Interrogation_Position=787; Antisense; ACATCTAATTTACTCCAGTCTGGGA
>probe:Drosophila_2:1634773_at:679:265; Interrogation_Position=802; Antisense; CAGTCTGGGACTGTCGTCTGGAGAC
>probe:Drosophila_2:1634773_at:199:493; Interrogation_Position=888; Antisense; GTCCATCAATGTTAAGCCTAGGCTG

Paste this into a BLAST search page for me
CCATGTCCTGGTGGTGAGGCCCAAGAAGGCCTTCGGCTACTTCAACTTCACCGAGGTGTCCTACAAGGCTGTCGAGGAGACGCTCCAACTGGCGGTCAGCGGAATTGTCAACCTGAACGAGTACAATTTCTTCGACTGGGTGGCCTTCGCTCTGTGGCACCAGTCCAAGAGCAAAACTAAGCTGCAGGACGGACGGTTTCTCGCCACCACCAAGAGATTTCTTTGAATTGATTCCATGCGTTGTTCATCTTTGTTCATCTATTCAACCCACACATACATCTAATTTACTCCAGTCTGGGACAGTCTGGGACTGTCGTCTGGAGACGTCCATCAATGTTAAGCCTAGGCTG

Full Affymetrix probeset data:

Annotations for 1634773_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720