Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634775_at:

>probe:Drosophila_2:1634775_at:101:525; Interrogation_Position=4175; Antisense; GGGCTCCTGTTCTGGCAGATAAAAA
>probe:Drosophila_2:1634775_at:127:371; Interrogation_Position=4228; Antisense; GAATGGGCTCGTAAGTTTTTAGAGA
>probe:Drosophila_2:1634775_at:710:193; Interrogation_Position=4265; Antisense; AAGCAGAGGTGGCTAACCCTACCCT
>probe:Drosophila_2:1634775_at:506:659; Interrogation_Position=4278; Antisense; TAACCCTACCCTAGCCGAAGTGTCG
>probe:Drosophila_2:1634775_at:482:303; Interrogation_Position=4292; Antisense; CCGAAGTGTCGCCACAGGAAGATGA
>probe:Drosophila_2:1634775_at:546:209; Interrogation_Position=4420; Antisense; AAGACATCAAAGCAAGTCCTTGAGA
>probe:Drosophila_2:1634775_at:662:339; Interrogation_Position=4464; Antisense; GCTAAACTTGCAAAAGCCGAAGATG
>probe:Drosophila_2:1634775_at:75:173; Interrogation_Position=4509; Antisense; AAAGAAGTCGAAGGACCGGCAATGC
>probe:Drosophila_2:1634775_at:73:305; Interrogation_Position=4524; Antisense; CCGGCAATGCGGGAAGACACTAAAG
>probe:Drosophila_2:1634775_at:461:247; Interrogation_Position=4562; Antisense; AATTGGAGGCTCTAAAGACGGCCAA
>probe:Drosophila_2:1634775_at:176:407; Interrogation_Position=4578; Antisense; GACGGCCAAGGATACAATGGCAGCA
>probe:Drosophila_2:1634775_at:173:185; Interrogation_Position=4636; Antisense; AAAATGGCCCAGAAGATGTCAGAAA
>probe:Drosophila_2:1634775_at:398:169; Interrogation_Position=4727; Antisense; AAAGGAACCGTAGTGCCCCATACAG
>probe:Drosophila_2:1634775_at:689:485; Interrogation_Position=4736; Antisense; GTAGTGCCCCATACAGATATCTGAA

Paste this into a BLAST search page for me
GGGCTCCTGTTCTGGCAGATAAAAAGAATGGGCTCGTAAGTTTTTAGAGAAAGCAGAGGTGGCTAACCCTACCCTTAACCCTACCCTAGCCGAAGTGTCGCCGAAGTGTCGCCACAGGAAGATGAAAGACATCAAAGCAAGTCCTTGAGAGCTAAACTTGCAAAAGCCGAAGATGAAAGAAGTCGAAGGACCGGCAATGCCCGGCAATGCGGGAAGACACTAAAGAATTGGAGGCTCTAAAGACGGCCAAGACGGCCAAGGATACAATGGCAGCAAAAATGGCCCAGAAGATGTCAGAAAAAAGGAACCGTAGTGCCCCATACAGGTAGTGCCCCATACAGATATCTGAA

Full Affymetrix probeset data:

Annotations for 1634775_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime