Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634776_at:

>probe:Drosophila_2:1634776_at:79:709; Interrogation_Position=1399; Antisense; TTAAAAATTTCGATGCCCGCGCTTT
>probe:Drosophila_2:1634776_at:141:697; Interrogation_Position=1421; Antisense; TTTCGAGCCGCTTTCACAATTGGAA
>probe:Drosophila_2:1634776_at:299:389; Interrogation_Position=1443; Antisense; GAAAAACTCCGCATTGACTCCAACA
>probe:Drosophila_2:1634776_at:151:187; Interrogation_Position=1464; Antisense; AACAAGCTGATGTTTCTGCCGCATG
>probe:Drosophila_2:1634776_at:76:349; Interrogation_Position=1484; Antisense; GCATGGAGCTCTTCATGGCCTGAAA
>probe:Drosophila_2:1634776_at:710:243; Interrogation_Position=1509; Antisense; AATTTGGTGGCCGTCAAACTGGACA
>probe:Drosophila_2:1634776_at:454:559; Interrogation_Position=1529; Antisense; GGACAAGAATCCCTGGCACTGCGAT
>probe:Drosophila_2:1634776_at:124:145; Interrogation_Position=1546; Antisense; ACTGCGATTGCCGAGCTCTATATTT
>probe:Drosophila_2:1634776_at:625:417; Interrogation_Position=1558; Antisense; GAGCTCTATATTTGGCCAGGTGGAT
>probe:Drosophila_2:1634776_at:375:687; Interrogation_Position=1590; Antisense; TTTGTGCTGAAACTCTGGGACGGAC
>probe:Drosophila_2:1634776_at:575:493; Interrogation_Position=1651; Antisense; GTCACGAGGTGGGACTACTGCGTTA
>probe:Drosophila_2:1634776_at:222:669; Interrogation_Position=1666; Antisense; TACTGCGTTATGATGACCTCTGCGA
>probe:Drosophila_2:1634776_at:249:85; Interrogation_Position=1696; Antisense; AGTGGGCCAGCATGTTGTCCCTTTC
>probe:Drosophila_2:1634776_at:122:439; Interrogation_Position=1833; Antisense; GAGGCCGATATAACCAGCGTGTCCA

Paste this into a BLAST search page for me
TTAAAAATTTCGATGCCCGCGCTTTTTTCGAGCCGCTTTCACAATTGGAAGAAAAACTCCGCATTGACTCCAACAAACAAGCTGATGTTTCTGCCGCATGGCATGGAGCTCTTCATGGCCTGAAAAATTTGGTGGCCGTCAAACTGGACAGGACAAGAATCCCTGGCACTGCGATACTGCGATTGCCGAGCTCTATATTTGAGCTCTATATTTGGCCAGGTGGATTTTGTGCTGAAACTCTGGGACGGACGTCACGAGGTGGGACTACTGCGTTATACTGCGTTATGATGACCTCTGCGAAGTGGGCCAGCATGTTGTCCCTTTCGAGGCCGATATAACCAGCGTGTCCA

Full Affymetrix probeset data:

Annotations for 1634776_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime