FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634778_at:

>probe:Drosophila_2:1634778_at:512:55; Interrogation_Position=1050; Antisense; ATGAAATCCGCTCAGAATCCGTCTA
>probe:Drosophila_2:1634778_at:728:371; Interrogation_Position=1096; Antisense; GAAGGATCCTGCACCGCATGGACGA
>probe:Drosophila_2:1634778_at:221:713; Interrogation_Position=1140; Antisense; TTCTACAAGATCCTAACCTTCGACG
>probe:Drosophila_2:1634778_at:537:139; Interrogation_Position=1162; Antisense; ACGTCCTCAACTATGATCCGCAGAA
>probe:Drosophila_2:1634778_at:208:131; Interrogation_Position=1201; Antisense; ACCCGTCCGACGATAAGCCTTAGTG
>probe:Drosophila_2:1634778_at:411:153; Interrogation_Position=748; Antisense; ACATGCTGTTTGTGGGCCTGCGAAA
>probe:Drosophila_2:1634778_at:654:249; Interrogation_Position=776; Antisense; CAAGGACTTTGATACGGCCACCGAG
>probe:Drosophila_2:1634778_at:558:435; Interrogation_Position=807; Antisense; GAGGTCAGTGAGATCATCCGCCGGA
>probe:Drosophila_2:1634778_at:481:45; Interrogation_Position=822; Antisense; ATCCGCCGGATGGACAACGAGCTTA
>probe:Drosophila_2:1634778_at:137:649; Interrogation_Position=845; Antisense; TAAGACACCGCCAGAGGTCGTAGCT
>probe:Drosophila_2:1634778_at:516:119; Interrogation_Position=866; Antisense; AGCTGTTCCGCATCGAATTGTTTTC
>probe:Drosophila_2:1634778_at:94:319; Interrogation_Position=891; Antisense; GCCGAGATCTTCATCCGCTTTAGAA
>probe:Drosophila_2:1634778_at:263:107; Interrogation_Position=912; Antisense; AGAAGGGACTACACGGCTGATGCCA
>probe:Drosophila_2:1634778_at:698:683; Interrogation_Position=960; Antisense; TATCCTTCATTCAGTGCTACCACAA

Paste this into a BLAST search page for me
ATGAAATCCGCTCAGAATCCGTCTAGAAGGATCCTGCACCGCATGGACGATTCTACAAGATCCTAACCTTCGACGACGTCCTCAACTATGATCCGCAGAAACCCGTCCGACGATAAGCCTTAGTGACATGCTGTTTGTGGGCCTGCGAAACAAGGACTTTGATACGGCCACCGAGGAGGTCAGTGAGATCATCCGCCGGAATCCGCCGGATGGACAACGAGCTTATAAGACACCGCCAGAGGTCGTAGCTAGCTGTTCCGCATCGAATTGTTTTCGCCGAGATCTTCATCCGCTTTAGAAAGAAGGGACTACACGGCTGATGCCATATCCTTCATTCAGTGCTACCACAA

Full Affymetrix probeset data:

Annotations for 1634778_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720