FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634780_at:

>probe:Drosophila_2:1634780_at:98:707; Interrogation_Position=1006; Antisense; TTACGACGTCGCCTGAACTGCAAAT
>probe:Drosophila_2:1634780_at:522:381; Interrogation_Position=1020; Antisense; GAACTGCAAATCCTTCGAATGGTAT
>probe:Drosophila_2:1634780_at:585:221; Interrogation_Position=1052; Antisense; AAGTGGCGCCGCAAATCAGGAACCA
>probe:Drosophila_2:1634780_at:277:647; Interrogation_Position=1067; Antisense; TCAGGAACCACTTTCTTCATGCCGG
>probe:Drosophila_2:1634780_at:651:47; Interrogation_Position=1085; Antisense; ATGCCGGTCTTACCAACTATCCGAT
>probe:Drosophila_2:1634780_at:156:165; Interrogation_Position=1115; Antisense; AAATAATGCCCTTTGTGGCGCCACA
>probe:Drosophila_2:1634780_at:432:581; Interrogation_Position=1130; Antisense; TGGCGCCACATTTTTGCTTATCGAT
>probe:Drosophila_2:1634780_at:274:211; Interrogation_Position=1202; Antisense; AAGACTGGACACTGACGTCTCGTTG
>probe:Drosophila_2:1634780_at:554:329; Interrogation_Position=1278; Antisense; GCGGGCTACGAAATGCACTAAAAAA
>probe:Drosophila_2:1634780_at:374:557; Interrogation_Position=1393; Antisense; GGACTCATTTTAAGTGCTTGCGATT
>probe:Drosophila_2:1634780_at:153:349; Interrogation_Position=1455; Antisense; GCAGGACTTCAAACTAGACCACATG
>probe:Drosophila_2:1634780_at:355:659; Interrogation_Position=933; Antisense; TAAGCTGCACTTTTATCGATACAAT
>probe:Drosophila_2:1634780_at:36:393; Interrogation_Position=968; Antisense; GAAACCTTACTGCAGAATCGCTGGA
>probe:Drosophila_2:1634780_at:283:157; Interrogation_Position=992; Antisense; ACAAGCCGCGGGATTTACGACGTCG

Paste this into a BLAST search page for me
TTACGACGTCGCCTGAACTGCAAATGAACTGCAAATCCTTCGAATGGTATAAGTGGCGCCGCAAATCAGGAACCATCAGGAACCACTTTCTTCATGCCGGATGCCGGTCTTACCAACTATCCGATAAATAATGCCCTTTGTGGCGCCACATGGCGCCACATTTTTGCTTATCGATAAGACTGGACACTGACGTCTCGTTGGCGGGCTACGAAATGCACTAAAAAAGGACTCATTTTAAGTGCTTGCGATTGCAGGACTTCAAACTAGACCACATGTAAGCTGCACTTTTATCGATACAATGAAACCTTACTGCAGAATCGCTGGAACAAGCCGCGGGATTTACGACGTCG

Full Affymetrix probeset data:

Annotations for 1634780_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720