Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634783_s_at:

>probe:Drosophila_2:1634783_s_at:4:711; Interrogation_Position=141; Antisense; TTAACCGATCTGACCGGGTGCCTAA
>probe:Drosophila_2:1634783_s_at:433:523; Interrogation_Position=156; Antisense; GGGTGCCTAATTAACCACCAGACCT
>probe:Drosophila_2:1634783_s_at:435:129; Interrogation_Position=172; Antisense; ACCAGACCTACGACAAGTGCGGAAA
>probe:Drosophila_2:1634783_s_at:214:67; Interrogation_Position=213; Antisense; ATGGAGTGCTTCGAGGCCTATGGCC
>probe:Drosophila_2:1634783_s_at:407:387; Interrogation_Position=247; Antisense; GAAAACGGGAGTGCGCCGACCTGAT
>probe:Drosophila_2:1634783_s_at:342:413; Interrogation_Position=264; Antisense; GACCTGATCTCCGACTTTCAGGAGT
>probe:Drosophila_2:1634783_s_at:173:149; Interrogation_Position=277; Antisense; ACTTTCAGGAGTGCGTCGGCATGCA
>probe:Drosophila_2:1634783_s_at:446:329; Interrogation_Position=289; Antisense; GCGTCGGCATGCAGAAGCAACTGAT
>probe:Drosophila_2:1634783_s_at:720:143; Interrogation_Position=308; Antisense; ACTGATGCGCTTCCATGCAATGCGA
>probe:Drosophila_2:1634783_s_at:69:137; Interrogation_Position=334; Antisense; ACGAACGCTACAAGCAGTGGCTCAA
>probe:Drosophila_2:1634783_s_at:214:399; Interrogation_Position=36; Antisense; GACAGTCTTGTTTTTGTGCTGGAAT
>probe:Drosophila_2:1634783_s_at:298:605; Interrogation_Position=404; Antisense; TGATGCCTACTAGACGGAGACCCGT
>probe:Drosophila_2:1634783_s_at:583:477; Interrogation_Position=427; Antisense; GTTTTTCTTGGTTAGTTTCACATTG
>probe:Drosophila_2:1634783_s_at:181:107; Interrogation_Position=73; Antisense; AGACAATTCCTTGGGTATTGCCAAC

Paste this into a BLAST search page for me
TTAACCGATCTGACCGGGTGCCTAAGGGTGCCTAATTAACCACCAGACCTACCAGACCTACGACAAGTGCGGAAAATGGAGTGCTTCGAGGCCTATGGCCGAAAACGGGAGTGCGCCGACCTGATGACCTGATCTCCGACTTTCAGGAGTACTTTCAGGAGTGCGTCGGCATGCAGCGTCGGCATGCAGAAGCAACTGATACTGATGCGCTTCCATGCAATGCGAACGAACGCTACAAGCAGTGGCTCAAGACAGTCTTGTTTTTGTGCTGGAATTGATGCCTACTAGACGGAGACCCGTGTTTTTCTTGGTTAGTTTCACATTGAGACAATTCCTTGGGTATTGCCAAC

Full Affymetrix probeset data:

Annotations for 1634783_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime