Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634784_at:

>probe:Drosophila_2:1634784_at:371:563; Interrogation_Position=3654; Antisense; GGAATGGGATCCTCAGCGCCCAGTA
>probe:Drosophila_2:1634784_at:336:261; Interrogation_Position=3683; Antisense; CACGCGCCAATGACATTCGGGATCG
>probe:Drosophila_2:1634784_at:628:55; Interrogation_Position=3692; Antisense; ATGACATTCGGGATCGGCCGCACAG
>probe:Drosophila_2:1634784_at:212:619; Interrogation_Position=3731; Antisense; TGCTGTGACGGCCTTTTACAACCAG
>probe:Drosophila_2:1634784_at:536:707; Interrogation_Position=3746; Antisense; TTACAACCAGGAGGCGATGGCCGCC
>probe:Drosophila_2:1634784_at:482:159; Interrogation_Position=3978; Antisense; ACAAAGTTCATTTAGCTAGGGTCAC
>probe:Drosophila_2:1634784_at:265:705; Interrogation_Position=3989; Antisense; TTAGCTAGGGTCACTCAGCTCGTTC
>probe:Drosophila_2:1634784_at:114:639; Interrogation_Position=4008; Antisense; TCGTTCCCTTGCGATTCTAATCTAA
>probe:Drosophila_2:1634784_at:344:679; Interrogation_Position=4038; Antisense; TAGTGCTGATTCTAGGTAGGTTTCA
>probe:Drosophila_2:1634784_at:480:485; Interrogation_Position=4053; Antisense; GTAGGTTTCATTCGCAGCTGTGTCT
>probe:Drosophila_2:1634784_at:500:515; Interrogation_Position=4072; Antisense; GTGTCTGCCGATTTTCCAATTATTG
>probe:Drosophila_2:1634784_at:160:355; Interrogation_Position=4096; Antisense; GCACCAGTTTAATTATTGTTTCTCA
>probe:Drosophila_2:1634784_at:401:697; Interrogation_Position=4114; Antisense; TTTCTCATTGAGTCGTTTACCTACT
>probe:Drosophila_2:1634784_at:556:279; Interrogation_Position=4137; Antisense; CTAAGTCAGTGTACTATGCAAGCAT

Paste this into a BLAST search page for me
GGAATGGGATCCTCAGCGCCCAGTACACGCGCCAATGACATTCGGGATCGATGACATTCGGGATCGGCCGCACAGTGCTGTGACGGCCTTTTACAACCAGTTACAACCAGGAGGCGATGGCCGCCACAAAGTTCATTTAGCTAGGGTCACTTAGCTAGGGTCACTCAGCTCGTTCTCGTTCCCTTGCGATTCTAATCTAATAGTGCTGATTCTAGGTAGGTTTCAGTAGGTTTCATTCGCAGCTGTGTCTGTGTCTGCCGATTTTCCAATTATTGGCACCAGTTTAATTATTGTTTCTCATTTCTCATTGAGTCGTTTACCTACTCTAAGTCAGTGTACTATGCAAGCAT

Full Affymetrix probeset data:

Annotations for 1634784_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime