Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634786_at:

>probe:Drosophila_2:1634786_at:134:377; Interrogation_Position=258; Antisense; GAAGACATCGCTAACGGAATCGTGG
>probe:Drosophila_2:1634786_at:7:405; Interrogation_Position=372; Antisense; GACTAGTATAACGACGTCGCTGAAG
>probe:Drosophila_2:1634786_at:705:237; Interrogation_Position=438; Antisense; AATCGGATCGAGATATTTGCACATC
>probe:Drosophila_2:1634786_at:374:555; Interrogation_Position=485; Antisense; GGACCAGTGCTTTGAGCGCATGTCA
>probe:Drosophila_2:1634786_at:599:549; Interrogation_Position=517; Antisense; GGAGGTAATCTAGCCTCAATTATAA
>probe:Drosophila_2:1634786_at:310:403; Interrogation_Position=550; Antisense; GACTTTAATGCTATCGTTTCGCAAC
>probe:Drosophila_2:1634786_at:274:3; Interrogation_Position=598; Antisense; ATTGGCATTAGTGATCTGGCTGAAA
>probe:Drosophila_2:1634786_at:671:181; Interrogation_Position=620; Antisense; AAAAGGGCGTTTTCATATCTGTGTC
>probe:Drosophila_2:1634786_at:312:711; Interrogation_Position=631; Antisense; TTCATATCTGTGTCCTCCGGAAAGA
>probe:Drosophila_2:1634786_at:184:99; Interrogation_Position=653; Antisense; AGAGAGCACCTTTTTTGAAATGGAA
>probe:Drosophila_2:1634786_at:567:367; Interrogation_Position=675; Antisense; GAATCCTGGAGAGCCACTATACGAA
>probe:Drosophila_2:1634786_at:410:453; Interrogation_Position=706; Antisense; GATCAGCGTTGCGTTTCTATACATA
>probe:Drosophila_2:1634786_at:650:197; Interrogation_Position=730; Antisense; AACGGTGGCATGTGGGTTGCTTCTT
>probe:Drosophila_2:1634786_at:536:469; Interrogation_Position=745; Antisense; GTTGCTTCTTGTACTTCTGATTTCA

Paste this into a BLAST search page for me
GAAGACATCGCTAACGGAATCGTGGGACTAGTATAACGACGTCGCTGAAGAATCGGATCGAGATATTTGCACATCGGACCAGTGCTTTGAGCGCATGTCAGGAGGTAATCTAGCCTCAATTATAAGACTTTAATGCTATCGTTTCGCAACATTGGCATTAGTGATCTGGCTGAAAAAAAGGGCGTTTTCATATCTGTGTCTTCATATCTGTGTCCTCCGGAAAGAAGAGAGCACCTTTTTTGAAATGGAAGAATCCTGGAGAGCCACTATACGAAGATCAGCGTTGCGTTTCTATACATAAACGGTGGCATGTGGGTTGCTTCTTGTTGCTTCTTGTACTTCTGATTTCA

Full Affymetrix probeset data:

Annotations for 1634786_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime