FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634787_at:

>probe:Drosophila_2:1634787_at:553:611; Interrogation_Position=1028; Antisense; TGACTAGTCAGTGTCGCTGCCGAAA
>probe:Drosophila_2:1634787_at:111:475; Interrogation_Position=1192; Antisense; GTTAAATACGGCATCGGAATTTCAT
>probe:Drosophila_2:1634787_at:334:361; Interrogation_Position=1220; Antisense; GAAACGTGTAGGTGCGTGTTTTCCT
>probe:Drosophila_2:1634787_at:397:513; Interrogation_Position=1235; Antisense; GTGTTTTCCTTGTCCCATATACACA
>probe:Drosophila_2:1634787_at:533:405; Interrogation_Position=808; Antisense; GACGGGATCGGTCTTCCCAACTAGC
>probe:Drosophila_2:1634787_at:525:113; Interrogation_Position=834; Antisense; AGCAGCGCAGCTATCAGGACATCGA
>probe:Drosophila_2:1634787_at:556:647; Interrogation_Position=847; Antisense; TCAGGACATCGATCGGCCCACACAG
>probe:Drosophila_2:1634787_at:646:9; Interrogation_Position=885; Antisense; ATTCGCAGCCCGGTCCGAATGTGGC
>probe:Drosophila_2:1634787_at:521:369; Interrogation_Position=901; Antisense; GAATGTGGCCAGCATTTTCTAGGCT
>probe:Drosophila_2:1634787_at:566:345; Interrogation_Position=912; Antisense; GCATTTTCTAGGCTCTCCAAGACAA
>probe:Drosophila_2:1634787_at:649:389; Interrogation_Position=932; Antisense; GACAACCCTTCCAAGTACCTAGACA
>probe:Drosophila_2:1634787_at:438:671; Interrogation_Position=947; Antisense; TACCTAGACAACACACCACTACGAT
>probe:Drosophila_2:1634787_at:123:139; Interrogation_Position=967; Antisense; ACGATAATAGACAGCGGATTCCGCA
>probe:Drosophila_2:1634787_at:406:561; Interrogation_Position=994; Antisense; GGAACAGCAAAGACAACCCATGTGT

Paste this into a BLAST search page for me
TGACTAGTCAGTGTCGCTGCCGAAAGTTAAATACGGCATCGGAATTTCATGAAACGTGTAGGTGCGTGTTTTCCTGTGTTTTCCTTGTCCCATATACACAGACGGGATCGGTCTTCCCAACTAGCAGCAGCGCAGCTATCAGGACATCGATCAGGACATCGATCGGCCCACACAGATTCGCAGCCCGGTCCGAATGTGGCGAATGTGGCCAGCATTTTCTAGGCTGCATTTTCTAGGCTCTCCAAGACAAGACAACCCTTCCAAGTACCTAGACATACCTAGACAACACACCACTACGATACGATAATAGACAGCGGATTCCGCAGGAACAGCAAAGACAACCCATGTGT

Full Affymetrix probeset data:

Annotations for 1634787_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720