FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634788_at:

>probe:Drosophila_2:1634788_at:558:113; Interrogation_Position=1073; Antisense; AGCATCTTTCAATCCATGGGCATGG
>probe:Drosophila_2:1634788_at:35:323; Interrogation_Position=1118; Antisense; GCCCAGGCGGTTCAGGATTGCATTA
>probe:Drosophila_2:1634788_at:577:169; Interrogation_Position=1153; Antisense; AAAGGATTCCTGATTGCTGTCCAGC
>probe:Drosophila_2:1634788_at:674:597; Interrogation_Position=1170; Antisense; TGTCCAGCTGGCAAAGCGATTCCGG
>probe:Drosophila_2:1634788_at:411:711; Interrogation_Position=681; Antisense; TTAATCTTTACAATCGCACGCAGGC
>probe:Drosophila_2:1634788_at:55:479; Interrogation_Position=717; Antisense; GTTTAGCGGACCAACTGCGGCAGAA
>probe:Drosophila_2:1634788_at:712:461; Interrogation_Position=766; Antisense; GATTACTGTATGTCCAAGTCCTCAC
>probe:Drosophila_2:1634788_at:415:207; Interrogation_Position=792; Antisense; AAGCTTGCCAGGATGCCGATATCAT
>probe:Drosophila_2:1634788_at:567:75; Interrogation_Position=837; Antisense; AGGAGCCGCTTATCCAGTTGGCAGA
>probe:Drosophila_2:1634788_at:466:195; Interrogation_Position=873; Antisense; AACGGGCTGTTCATATTAACGCTGT
>probe:Drosophila_2:1634788_at:518:415; Interrogation_Position=900; Antisense; GAGCCGGCGAAGTTCACTTTTCGGA
>probe:Drosophila_2:1634788_at:131:581; Interrogation_Position=949; Antisense; GGCCAAGGTCTACGTGGATTGCTAT
>probe:Drosophila_2:1634788_at:650:541; Interrogation_Position=964; Antisense; GGATTGCTATGCCAATGCCGAGGCT
>probe:Drosophila_2:1634788_at:14:249; Interrogation_Position=990; Antisense; AATTGGTGGGATTACCTGCGCCGAT

Paste this into a BLAST search page for me
AGCATCTTTCAATCCATGGGCATGGGCCCAGGCGGTTCAGGATTGCATTAAAAGGATTCCTGATTGCTGTCCAGCTGTCCAGCTGGCAAAGCGATTCCGGTTAATCTTTACAATCGCACGCAGGCGTTTAGCGGACCAACTGCGGCAGAAGATTACTGTATGTCCAAGTCCTCACAAGCTTGCCAGGATGCCGATATCATAGGAGCCGCTTATCCAGTTGGCAGAAACGGGCTGTTCATATTAACGCTGTGAGCCGGCGAAGTTCACTTTTCGGAGGCCAAGGTCTACGTGGATTGCTATGGATTGCTATGCCAATGCCGAGGCTAATTGGTGGGATTACCTGCGCCGAT

Full Affymetrix probeset data:

Annotations for 1634788_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720