FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634789_at:

>probe:Drosophila_2:1634789_at:632:249; Interrogation_Position=304; Antisense; CAAGGAGGACTTATTTCTGGCGGAA
>probe:Drosophila_2:1634789_at:462:369; Interrogation_Position=326; Antisense; GAAGTAGTGGAGGACCCTTTGCCCA
>probe:Drosophila_2:1634789_at:366:371; Interrogation_Position=373; Antisense; GAAGGACTAATTTCTGATGCCAACA
>probe:Drosophila_2:1634789_at:710:153; Interrogation_Position=395; Antisense; ACAGTGGTGGTCCTTTTAACAGCAA
>probe:Drosophila_2:1634789_at:188:379; Interrogation_Position=446; Antisense; GAAGCGGTCTGCTCAGTGGAGCTAA
>probe:Drosophila_2:1634789_at:217:549; Interrogation_Position=475; Antisense; GGAGGACCATTTGCCAGTGATCATC
>probe:Drosophila_2:1634789_at:385:541; Interrogation_Position=517; Antisense; GGAGGAAATTCTGGAGGCCCTTTTG
>probe:Drosophila_2:1634789_at:580:433; Interrogation_Position=530; Antisense; GAGGCCCTTTTGGAAGTGACCCATG
>probe:Drosophila_2:1634789_at:598:613; Interrogation_Position=579; Antisense; TGAAGGACTTATTTTTGGTGCCAAT
>probe:Drosophila_2:1634789_at:646:533; Interrogation_Position=595; Antisense; GGTGCCAATAGTGGAGGCCCTTTTG
>probe:Drosophila_2:1634789_at:275:461; Interrogation_Position=635; Antisense; GATTTCATGGCGGAGGGCTAACTAG
>probe:Drosophila_2:1634789_at:649:517; Interrogation_Position=728; Antisense; GTGGAGGTCCCTTCGAAAGCAAAGA
>probe:Drosophila_2:1634789_at:24:659; Interrogation_Position=795; Antisense; TAAGATAGGTGGTCCTCTGGGCCAA
>probe:Drosophila_2:1634789_at:583:545; Interrogation_Position=853; Antisense; GGAGGCCCCTTTGGACAAGCTGAAA

Paste this into a BLAST search page for me
CAAGGAGGACTTATTTCTGGCGGAAGAAGTAGTGGAGGACCCTTTGCCCAGAAGGACTAATTTCTGATGCCAACAACAGTGGTGGTCCTTTTAACAGCAAGAAGCGGTCTGCTCAGTGGAGCTAAGGAGGACCATTTGCCAGTGATCATCGGAGGAAATTCTGGAGGCCCTTTTGGAGGCCCTTTTGGAAGTGACCCATGTGAAGGACTTATTTTTGGTGCCAATGGTGCCAATAGTGGAGGCCCTTTTGGATTTCATGGCGGAGGGCTAACTAGGTGGAGGTCCCTTCGAAAGCAAAGATAAGATAGGTGGTCCTCTGGGCCAAGGAGGCCCCTTTGGACAAGCTGAAA

Full Affymetrix probeset data:

Annotations for 1634789_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720