Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634794_at:

>probe:Drosophila_2:1634794_at:374:307; Interrogation_Position=1842; Antisense; CCATGAGACCCTTTTTCGGCTACAA
>probe:Drosophila_2:1634794_at:517:701; Interrogation_Position=1854; Antisense; TTTTCGGCTACAACTTCGGCGACTA
>probe:Drosophila_2:1634794_at:610:147; Interrogation_Position=1875; Antisense; ACTATCTGGGTCACTGGCTAAGCAT
>probe:Drosophila_2:1634794_at:202:581; Interrogation_Position=1909; Antisense; TGGCCAGGTGCCCAAGATCTTTCAC
>probe:Drosophila_2:1634794_at:171:413; Interrogation_Position=1924; Antisense; GATCTTTCACGTAAATTGGTTCCGA
>probe:Drosophila_2:1634794_at:399:355; Interrogation_Position=1962; Antisense; GCAAGTTCCTTTGGCCCGGATTCGG
>probe:Drosophila_2:1634794_at:556:421; Interrogation_Position=1988; Antisense; GAGAACTCACGAGTCCTGGACTGGA
>probe:Drosophila_2:1634794_at:139:317; Interrogation_Position=2064; Antisense; GCCTGCCCAGCAAGAATTCATTGAA
>probe:Drosophila_2:1634794_at:424:561; Interrogation_Position=2101; Antisense; GGAAAACATTGATCTCGACCAGCTT
>probe:Drosophila_2:1634794_at:215:415; Interrogation_Position=2117; Antisense; GACCAGCTTTTCGATCTGCCAAAAG
>probe:Drosophila_2:1634794_at:375:533; Interrogation_Position=2158; Antisense; GGTGGCTGCCATAGAGAGGTACTTC
>probe:Drosophila_2:1634794_at:572:227; Interrogation_Position=2240; Antisense; AAGGCGCGTGTTGCTGACATGTGAT
>probe:Drosophila_2:1634794_at:156:515; Interrogation_Position=2265; Antisense; GTGTGTGTTCCATAGGTTACTTCCT
>probe:Drosophila_2:1634794_at:709:667; Interrogation_Position=2282; Antisense; TACTTCCTAATCTAAGACCCCTTAT

Paste this into a BLAST search page for me
CCATGAGACCCTTTTTCGGCTACAATTTTCGGCTACAACTTCGGCGACTAACTATCTGGGTCACTGGCTAAGCATTGGCCAGGTGCCCAAGATCTTTCACGATCTTTCACGTAAATTGGTTCCGAGCAAGTTCCTTTGGCCCGGATTCGGGAGAACTCACGAGTCCTGGACTGGAGCCTGCCCAGCAAGAATTCATTGAAGGAAAACATTGATCTCGACCAGCTTGACCAGCTTTTCGATCTGCCAAAAGGGTGGCTGCCATAGAGAGGTACTTCAAGGCGCGTGTTGCTGACATGTGATGTGTGTGTTCCATAGGTTACTTCCTTACTTCCTAATCTAAGACCCCTTAT

Full Affymetrix probeset data:

Annotations for 1634794_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime