Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634795_a_at:

>probe:Drosophila_2:1634795_a_at:384:179; Interrogation_Position=384; Antisense; AAACTTTGTGGCTGACATTGCGCGT
>probe:Drosophila_2:1634795_a_at:234:151; Interrogation_Position=398; Antisense; ACATTGCGCGTCAGGAGGCAGCCAA
>probe:Drosophila_2:1634795_a_at:101:569; Interrogation_Position=414; Antisense; GGCAGCCAACTACAGACAGCAATTT
>probe:Drosophila_2:1634795_a_at:163:243; Interrogation_Position=434; Antisense; AATTTGAGCAGGCTATCCCGCTTAA
>probe:Drosophila_2:1634795_a_at:556:473; Interrogation_Position=487; Antisense; GTTCACGCCTACACTCTGTACAGTG
>probe:Drosophila_2:1634795_a_at:670:207; Interrogation_Position=583; Antisense; AAGCAGCTGGCCAAGACTGAGATGG
>probe:Drosophila_2:1634795_a_at:686:319; Interrogation_Position=650; Antisense; GCGCTGGTGAAATCATCTACAAAGT
>probe:Drosophila_2:1634795_a_at:114:541; Interrogation_Position=696; Antisense; GGACTTCCGCTTCGAAATGGGTTTG
>probe:Drosophila_2:1634795_a_at:360:77; Interrogation_Position=727; Antisense; AGGGTAACCGGTGGCCTACATCTCA
>probe:Drosophila_2:1634795_a_at:576:279; Interrogation_Position=742; Antisense; CTACATCTCATAAATCCCTCAGAAC
>probe:Drosophila_2:1634795_a_at:122:561; Interrogation_Position=782; Antisense; GGAAAGCCGGCGATGCGGCCAACAA
>probe:Drosophila_2:1634795_a_at:715:395; Interrogation_Position=820; Antisense; GACAATGAGACGCACTAGTTCGTTT
>probe:Drosophila_2:1634795_a_at:481:471; Interrogation_Position=837; Antisense; GTTCGTTTGTGTGCCAGTGAATCTA
>probe:Drosophila_2:1634795_a_at:246:511; Interrogation_Position=853; Antisense; GTGAATCTAATTCTGGGCCTCATAC

Paste this into a BLAST search page for me
AAACTTTGTGGCTGACATTGCGCGTACATTGCGCGTCAGGAGGCAGCCAAGGCAGCCAACTACAGACAGCAATTTAATTTGAGCAGGCTATCCCGCTTAAGTTCACGCCTACACTCTGTACAGTGAAGCAGCTGGCCAAGACTGAGATGGGCGCTGGTGAAATCATCTACAAAGTGGACTTCCGCTTCGAAATGGGTTTGAGGGTAACCGGTGGCCTACATCTCACTACATCTCATAAATCCCTCAGAACGGAAAGCCGGCGATGCGGCCAACAAGACAATGAGACGCACTAGTTCGTTTGTTCGTTTGTGTGCCAGTGAATCTAGTGAATCTAATTCTGGGCCTCATAC

Full Affymetrix probeset data:

Annotations for 1634795_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime