FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634796_at:

>probe:Drosophila_2:1634796_at:608:657; Interrogation_Position=1101; Antisense; TAAGTTCAAAACATAGCGGTAGCAT
>probe:Drosophila_2:1634796_at:266:179; Interrogation_Position=1127; Antisense; AAACAAGTTGGCAGCCCACTTTACA
>probe:Drosophila_2:1634796_at:382:139; Interrogation_Position=1174; Antisense; ACGTTCGTCAGCTGTGTTGTTGTAG
>probe:Drosophila_2:1634796_at:557:243; Interrogation_Position=675; Antisense; AATTTGGACGACTCTTTATCTGAAG
>probe:Drosophila_2:1634796_at:24:491; Interrogation_Position=727; Antisense; GTACAACCTTATATTCTGGAGATTG
>probe:Drosophila_2:1634796_at:232:429; Interrogation_Position=745; Antisense; GAGATTGGTCTCATTTTGCTGAACT
>probe:Drosophila_2:1634796_at:135:29; Interrogation_Position=788; Antisense; ATACGATCTAATACTTACCTCTGAG
>probe:Drosophila_2:1634796_at:654:171; Interrogation_Position=839; Antisense; AAAGCTCTTGGATACCTTTGCTGGT
>probe:Drosophila_2:1634796_at:691:123; Interrogation_Position=852; Antisense; ACCTTTGCTGGTCGCTTAAAATCCG
>probe:Drosophila_2:1634796_at:396:441; Interrogation_Position=876; Antisense; GATGGAGTCATTTTGGTTGCCGCAA
>probe:Drosophila_2:1634796_at:681:589; Interrogation_Position=889; Antisense; TGGTTGCCGCAAAATCTCATTATTT
>probe:Drosophila_2:1634796_at:353:15; Interrogation_Position=907; Antisense; ATTATTTTGGAGTTGGTGGCGGCCT
>probe:Drosophila_2:1634796_at:146:521; Interrogation_Position=922; Antisense; GTGGCGGCCTGGAACAGTTTTCAGA
>probe:Drosophila_2:1634796_at:29:101; Interrogation_Position=979; Antisense; AGAGTGTTTGGCAGGCAGACGAAAA

Paste this into a BLAST search page for me
TAAGTTCAAAACATAGCGGTAGCATAAACAAGTTGGCAGCCCACTTTACAACGTTCGTCAGCTGTGTTGTTGTAGAATTTGGACGACTCTTTATCTGAAGGTACAACCTTATATTCTGGAGATTGGAGATTGGTCTCATTTTGCTGAACTATACGATCTAATACTTACCTCTGAGAAAGCTCTTGGATACCTTTGCTGGTACCTTTGCTGGTCGCTTAAAATCCGGATGGAGTCATTTTGGTTGCCGCAATGGTTGCCGCAAAATCTCATTATTTATTATTTTGGAGTTGGTGGCGGCCTGTGGCGGCCTGGAACAGTTTTCAGAAGAGTGTTTGGCAGGCAGACGAAAA

Full Affymetrix probeset data:

Annotations for 1634796_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720