FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634798_at:

>probe:Drosophila_2:1634798_at:343:725; Interrogation_Position=402; Antisense; TTGATAACTTTTGATCCTGTGGCTG
>probe:Drosophila_2:1634798_at:76:581; Interrogation_Position=421; Antisense; TGGCTGGGTCCCGACTCTTGGTAAA
>probe:Drosophila_2:1634798_at:527:171; Interrogation_Position=450; Antisense; AAAGCATACCAGGTGGCAGTCCGTC
>probe:Drosophila_2:1634798_at:541:335; Interrogation_Position=501; Antisense; GCTCCATCTATCTGCGATTCGAATA
>probe:Drosophila_2:1634798_at:498:449; Interrogation_Position=545; Antisense; GATCGCCCAGAACTATTGCACCAAA
>probe:Drosophila_2:1634798_at:646:645; Interrogation_Position=589; Antisense; TCTTCAGCAGTGGTGCGGCGCACGA
>probe:Drosophila_2:1634798_at:187:285; Interrogation_Position=621; Antisense; CTGAGAGGACCTTACGACGTTGCTA
>probe:Drosophila_2:1634798_at:350:409; Interrogation_Position=636; Antisense; GACGTTGCTAATTTGGCCTTTATCT
>probe:Drosophila_2:1634798_at:186:701; Interrogation_Position=655; Antisense; TTATCTTCGGCCTATCAGAGGACCA
>probe:Drosophila_2:1634798_at:3:185; Interrogation_Position=685; Antisense; AAAATGCTGTGGACGGGCACTGCCG
>probe:Drosophila_2:1634798_at:95:353; Interrogation_Position=701; Antisense; GCACTGCCGGGAACTTTTCCTGAAG
>probe:Drosophila_2:1634798_at:69:285; Interrogation_Position=727; Antisense; CTGAGGCGCGTCGTCTGGGAAAAAC
>probe:Drosophila_2:1634798_at:307:559; Interrogation_Position=768; Antisense; GGAAACGGTCCCATAATATACTCGG
>probe:Drosophila_2:1634798_at:414:685; Interrogation_Position=784; Antisense; TATACTCGGATAGCTCTGAGGACGA

Paste this into a BLAST search page for me
TTGATAACTTTTGATCCTGTGGCTGTGGCTGGGTCCCGACTCTTGGTAAAAAAGCATACCAGGTGGCAGTCCGTCGCTCCATCTATCTGCGATTCGAATAGATCGCCCAGAACTATTGCACCAAATCTTCAGCAGTGGTGCGGCGCACGACTGAGAGGACCTTACGACGTTGCTAGACGTTGCTAATTTGGCCTTTATCTTTATCTTCGGCCTATCAGAGGACCAAAAATGCTGTGGACGGGCACTGCCGGCACTGCCGGGAACTTTTCCTGAAGCTGAGGCGCGTCGTCTGGGAAAAACGGAAACGGTCCCATAATATACTCGGTATACTCGGATAGCTCTGAGGACGA

Full Affymetrix probeset data:

Annotations for 1634798_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720