FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634800_at:

>probe:Drosophila_2:1634800_at:537:73; Interrogation_Position=1037; Antisense; AGGACAAGCGATACCAGCGGACTGT
>probe:Drosophila_2:1634800_at:192:407; Interrogation_Position=1056; Antisense; GACTGTCATCCAGTTCCTGCAGAAA
>probe:Drosophila_2:1634800_at:625:269; Interrogation_Position=1140; Antisense; CATCAATGTAGCCAAGTTCGCCTTC
>probe:Drosophila_2:1634800_at:631:487; Interrogation_Position=1170; Antisense; GTACGCCATCGCGAGCGGTATGAAC
>probe:Drosophila_2:1634800_at:377:461; Interrogation_Position=625; Antisense; GATTCCTACCCTGTGATTTACGTGG
>probe:Drosophila_2:1634800_at:170:385; Interrogation_Position=659; Antisense; GAACTCATATTCTCTTGCTCAAGGA
>probe:Drosophila_2:1634800_at:642:291; Interrogation_Position=685; Antisense; CGTATCATTTACTTGGGCGATCCCA
>probe:Drosophila_2:1634800_at:3:327; Interrogation_Position=725; Antisense; GCGACCCGAGCTACATGTTTAAATC
>probe:Drosophila_2:1634800_at:435:251; Interrogation_Position=805; Antisense; CAACCAATCATCTCTGGCACGATAT
>probe:Drosophila_2:1634800_at:620:687; Interrogation_Position=827; Antisense; TATTTGCCCAATTCATCATATGCGG
>probe:Drosophila_2:1634800_at:294:331; Interrogation_Position=848; Antisense; GCGGATCGATCCTGGGCATAATTAT
>probe:Drosophila_2:1634800_at:629:725; Interrogation_Position=886; Antisense; TTGTTCGCTGATCAATCGACCCGAT
>probe:Drosophila_2:1634800_at:401:25; Interrogation_Position=916; Antisense; ATAGTCATCTACGTTATGGCCGTCC
>probe:Drosophila_2:1634800_at:139:409; Interrogation_Position=985; Antisense; GACGACTGCAAAGAACTGGCCCACG

Paste this into a BLAST search page for me
AGGACAAGCGATACCAGCGGACTGTGACTGTCATCCAGTTCCTGCAGAAACATCAATGTAGCCAAGTTCGCCTTCGTACGCCATCGCGAGCGGTATGAACGATTCCTACCCTGTGATTTACGTGGGAACTCATATTCTCTTGCTCAAGGACGTATCATTTACTTGGGCGATCCCAGCGACCCGAGCTACATGTTTAAATCCAACCAATCATCTCTGGCACGATATTATTTGCCCAATTCATCATATGCGGGCGGATCGATCCTGGGCATAATTATTTGTTCGCTGATCAATCGACCCGATATAGTCATCTACGTTATGGCCGTCCGACGACTGCAAAGAACTGGCCCACG

Full Affymetrix probeset data:

Annotations for 1634800_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720