FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634801_at:

>probe:Drosophila_2:1634801_at:297:151; Interrogation_Position=128; Antisense; ACATCTTCCTGCTGTGCGGAACGTA
>probe:Drosophila_2:1634801_at:376:185; Interrogation_Position=147; Antisense; AACGTACGGCGGCTCGGTGATCATA
>probe:Drosophila_2:1634801_at:12:573; Interrogation_Position=157; Antisense; GGCTCGGTGATCATATGCTTCATAT
>probe:Drosophila_2:1634801_at:557:141; Interrogation_Position=183; Antisense; ACTGATTGGAGCTTTCTACGCCGAG
>probe:Drosophila_2:1634801_at:497:37; Interrogation_Position=244; Antisense; ATCTTGGGTGGCCTGCACATGGTCA
>probe:Drosophila_2:1634801_at:297:65; Interrogation_Position=262; Antisense; ATGGTCACCGTGTACGCCAACATGT
>probe:Drosophila_2:1634801_at:378:341; Interrogation_Position=329; Antisense; GCTTCTATGCGTGCTGTCGGGACAA
>probe:Drosophila_2:1634801_at:466:527; Interrogation_Position=347; Antisense; GGGACAACGCCATTGTGGCTCTGTA
>probe:Drosophila_2:1634801_at:388:577; Interrogation_Position=376; Antisense; GGCGCCATTTATCTGATGCACTGCA
>probe:Drosophila_2:1634801_at:519:129; Interrogation_Position=400; Antisense; ACCTTCGCTCTGGATCTCATGTTCT
>probe:Drosophila_2:1634801_at:466:375; Interrogation_Position=450; Antisense; GAAGATGCATCCACAGCGGAGCAAG
>probe:Drosophila_2:1634801_at:598:551; Interrogation_Position=467; Antisense; GGAGCAAGCGACCACTGCAGCTGTA
>probe:Drosophila_2:1634801_at:555:35; Interrogation_Position=518; Antisense; ATCTCAGTCGCTTCTGGTTCTTTCG
>probe:Drosophila_2:1634801_at:69:505; Interrogation_Position=91; Antisense; GTCCATTGGACCTGCTTCATGGAGG

Paste this into a BLAST search page for me
ACATCTTCCTGCTGTGCGGAACGTAAACGTACGGCGGCTCGGTGATCATAGGCTCGGTGATCATATGCTTCATATACTGATTGGAGCTTTCTACGCCGAGATCTTGGGTGGCCTGCACATGGTCAATGGTCACCGTGTACGCCAACATGTGCTTCTATGCGTGCTGTCGGGACAAGGGACAACGCCATTGTGGCTCTGTAGGCGCCATTTATCTGATGCACTGCAACCTTCGCTCTGGATCTCATGTTCTGAAGATGCATCCACAGCGGAGCAAGGGAGCAAGCGACCACTGCAGCTGTAATCTCAGTCGCTTCTGGTTCTTTCGGTCCATTGGACCTGCTTCATGGAGG

Full Affymetrix probeset data:

Annotations for 1634801_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720