FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634804_at:

>probe:Drosophila_2:1634804_at:78:683; Interrogation_Position=1270; Antisense; TATTCTGTGCTAAACGACCAGTTCC
>probe:Drosophila_2:1634804_at:679:413; Interrogation_Position=1285; Antisense; GACCAGTTCCATAAGTTCCAGTTAA
>probe:Drosophila_2:1634804_at:637:473; Interrogation_Position=1329; Antisense; GTTAATTTGACTATGCTTAAGCGAC
>probe:Drosophila_2:1634804_at:614:325; Interrogation_Position=1349; Antisense; GCGACTATGATTTAGATTCCCACTT
>probe:Drosophila_2:1634804_at:21:95; Interrogation_Position=1362; Antisense; AGATTCCCACTTTATTGTTGTTAGA
>probe:Drosophila_2:1634804_at:620:515; Interrogation_Position=1422; Antisense; GTGTACATTTTTTCATAGCATGCAA
>probe:Drosophila_2:1634804_at:486:607; Interrogation_Position=1542; Antisense; TGAGCTATCGGCTAATGATGCACTT
>probe:Drosophila_2:1634804_at:256:607; Interrogation_Position=1557; Antisense; TGATGCACTTTACGCAACCTATACC
>probe:Drosophila_2:1634804_at:210:129; Interrogation_Position=1568; Antisense; ACGCAACCTATACCAGTTACTTTAT
>probe:Drosophila_2:1634804_at:491:39; Interrogation_Position=1601; Antisense; ATCTGCTAACTTTGTGTCTTCTTCA
>probe:Drosophila_2:1634804_at:545:515; Interrogation_Position=1614; Antisense; GTGTCTTCTTCAGAACTCCAAATGG
>probe:Drosophila_2:1634804_at:394:145; Interrogation_Position=1628; Antisense; ACTCCAAATGGCTAAGGAATCGTTT
>probe:Drosophila_2:1634804_at:499:479; Interrogation_Position=1694; Antisense; GTGTTAGACAAATAAGTTCCCGCAA
>probe:Drosophila_2:1634804_at:398:469; Interrogation_Position=1709; Antisense; GTTCCCGCAAGCAACAGAACTTACC

Paste this into a BLAST search page for me
TATTCTGTGCTAAACGACCAGTTCCGACCAGTTCCATAAGTTCCAGTTAAGTTAATTTGACTATGCTTAAGCGACGCGACTATGATTTAGATTCCCACTTAGATTCCCACTTTATTGTTGTTAGAGTGTACATTTTTTCATAGCATGCAATGAGCTATCGGCTAATGATGCACTTTGATGCACTTTACGCAACCTATACCACGCAACCTATACCAGTTACTTTATATCTGCTAACTTTGTGTCTTCTTCAGTGTCTTCTTCAGAACTCCAAATGGACTCCAAATGGCTAAGGAATCGTTTGTGTTAGACAAATAAGTTCCCGCAAGTTCCCGCAAGCAACAGAACTTACC

Full Affymetrix probeset data:

Annotations for 1634804_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720