Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634805_at:

>probe:Drosophila_2:1634805_at:213:35; Interrogation_Position=1333; Antisense; ATCAGCCCAACAACTATTTTCACAG
>probe:Drosophila_2:1634805_at:540:319; Interrogation_Position=1337; Antisense; GCCCAACAACTATTTTCACAGGAGA
>probe:Drosophila_2:1634805_at:7:251; Interrogation_Position=1343; Antisense; CAACTATTTTCACAGGAGATATTTA
>probe:Drosophila_2:1634805_at:39:31; Interrogation_Position=1369; Antisense; ATACATTGCTACAACATTACACTAG
>probe:Drosophila_2:1634805_at:694:619; Interrogation_Position=1375; Antisense; TGCTACAACATTACACTAGTGAATT
>probe:Drosophila_2:1634805_at:639:371; Interrogation_Position=828; Antisense; GAAGTGGAGTGGGTACCCAACAAGA
>probe:Drosophila_2:1634805_at:631:81; Interrogation_Position=835; Antisense; AGTGGGTACCCAACAAGACAGAAGT
>probe:Drosophila_2:1634805_at:112:537; Interrogation_Position=839; Antisense; GGTACCCAACAAGACAGAAGTGCGA
>probe:Drosophila_2:1634805_at:379:155; Interrogation_Position=852; Antisense; ACAGAAGTGCGACCGCTGTTTGCTA
>probe:Drosophila_2:1634805_at:724:219; Interrogation_Position=856; Antisense; AAGTGCGACCGCTGTTTGCTAACAC
>probe:Drosophila_2:1634805_at:525:411; Interrogation_Position=862; Antisense; GACCGCTGTTTGCTAACACGATTCT
>probe:Drosophila_2:1634805_at:628:479; Interrogation_Position=869; Antisense; GTTTGCTAACACGATTCTCTAAGAC
>probe:Drosophila_2:1634805_at:446:187; Interrogation_Position=876; Antisense; AACACGATTCTCTAAGACTGACGGA
>probe:Drosophila_2:1634805_at:109:3; Interrogation_Position=882; Antisense; ATTCTCTAAGACTGACGGAATACGT

Paste this into a BLAST search page for me
ATCAGCCCAACAACTATTTTCACAGGCCCAACAACTATTTTCACAGGAGACAACTATTTTCACAGGAGATATTTAATACATTGCTACAACATTACACTAGTGCTACAACATTACACTAGTGAATTGAAGTGGAGTGGGTACCCAACAAGAAGTGGGTACCCAACAAGACAGAAGTGGTACCCAACAAGACAGAAGTGCGAACAGAAGTGCGACCGCTGTTTGCTAAAGTGCGACCGCTGTTTGCTAACACGACCGCTGTTTGCTAACACGATTCTGTTTGCTAACACGATTCTCTAAGACAACACGATTCTCTAAGACTGACGGAATTCTCTAAGACTGACGGAATACGT

Full Affymetrix probeset data:

Annotations for 1634805_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime