FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634806_at:

>probe:Drosophila_2:1634806_at:207:355; Interrogation_Position=100; Antisense; GCACAATTCTGGTCGGTGGATCCTG
>probe:Drosophila_2:1634806_at:493:519; Interrogation_Position=115; Antisense; GTGGATCCTGTTACGCAGTGGCGAA
>probe:Drosophila_2:1634806_at:662:367; Interrogation_Position=15; Antisense; GAATCCGAGCGAAATGCACTTGACA
>probe:Drosophila_2:1634806_at:381:419; Interrogation_Position=161; Antisense; GATCCGGCATCTGTTACAGGACGCT
>probe:Drosophila_2:1634806_at:401:75; Interrogation_Position=178; Antisense; AGGACGCTCACCGTGGAAACCATCA
>probe:Drosophila_2:1634806_at:182:231; Interrogation_Position=202; Antisense; AATCCCAACTCCAGAAATCGTCAGT
>probe:Drosophila_2:1634806_at:450:395; Interrogation_Position=215; Antisense; GAAATCGTCAGTTCTCCTACTGCTG
>probe:Drosophila_2:1634806_at:327:307; Interrogation_Position=230; Antisense; CCTACTGCTGCGATGGTTATGTGAA
>probe:Drosophila_2:1634806_at:620:107; Interrogation_Position=269; Antisense; AGAACCTGAAGTGCGAGCCCATTTG
>probe:Drosophila_2:1634806_at:601:19; Interrogation_Position=289; Antisense; ATTTGCTCGGAGGACTGCTCCAATG
>probe:Drosophila_2:1634806_at:443:355; Interrogation_Position=30; Antisense; GCACTTGACATCCACGCTGATTGGA
>probe:Drosophila_2:1634806_at:703:619; Interrogation_Position=304; Antisense; TGCTCCAATGGATTGTGCCTGGCGC
>probe:Drosophila_2:1634806_at:583:501; Interrogation_Position=336; Antisense; GTGCGAGTGTGCTCCGGGTTACTAT
>probe:Drosophila_2:1634806_at:207:5; Interrogation_Position=49; Antisense; ATTGGACTCCTTATCTGCGGTCTGG

Paste this into a BLAST search page for me
GCACAATTCTGGTCGGTGGATCCTGGTGGATCCTGTTACGCAGTGGCGAAGAATCCGAGCGAAATGCACTTGACAGATCCGGCATCTGTTACAGGACGCTAGGACGCTCACCGTGGAAACCATCAAATCCCAACTCCAGAAATCGTCAGTGAAATCGTCAGTTCTCCTACTGCTGCCTACTGCTGCGATGGTTATGTGAAAGAACCTGAAGTGCGAGCCCATTTGATTTGCTCGGAGGACTGCTCCAATGGCACTTGACATCCACGCTGATTGGATGCTCCAATGGATTGTGCCTGGCGCGTGCGAGTGTGCTCCGGGTTACTATATTGGACTCCTTATCTGCGGTCTGG

Full Affymetrix probeset data:

Annotations for 1634806_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720