FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634808_at:

>probe:Drosophila_2:1634808_at:394:241; Interrogation_Position=295; Antisense; AATATCCAACGTCACTTAGCAAGTC
>probe:Drosophila_2:1634808_at:57:175; Interrogation_Position=346; Antisense; AAAGCCCTAAATCTATCCGTGGAAG
>probe:Drosophila_2:1634808_at:691:77; Interrogation_Position=378; Antisense; AGTGATGCCGAAAACCGAAATCCCA
>probe:Drosophila_2:1634808_at:718:215; Interrogation_Position=415; Antisense; AAGATTGGCTGGAGGCATTTTTTCA
>probe:Drosophila_2:1634808_at:225:65; Interrogation_Position=493; Antisense; ATGGGTGCTCATCTGTTGACAATCC
>probe:Drosophila_2:1634808_at:679:243; Interrogation_Position=530; Antisense; AATTGGATGCTATCCGTACGGAACT
>probe:Drosophila_2:1634808_at:345:137; Interrogation_Position=578; Antisense; ACGACTTCTGGCTGGACATCAATGA
>probe:Drosophila_2:1634808_at:451:523; Interrogation_Position=615; Antisense; GGGCGAATTCATTTCTTTAGCAACG
>probe:Drosophila_2:1634808_at:227:563; Interrogation_Position=640; Antisense; GGAATGAATCCACCCTTTTTGAAAT
>probe:Drosophila_2:1634808_at:368:681; Interrogation_Position=675; Antisense; TAGGCCTCAGGTGCAAATTCATCAG
>probe:Drosophila_2:1634808_at:33:535; Interrogation_Position=684; Antisense; GGTGCAAATTCATCAGCGCTGTGTT
>probe:Drosophila_2:1634808_at:28:263; Interrogation_Position=697; Antisense; CAGCGCTGTGTTCACTTACGTGGAG
>probe:Drosophila_2:1634808_at:96:219; Interrogation_Position=739; Antisense; AAGTGCAGCGAACAGTTTCTTTTTA
>probe:Drosophila_2:1634808_at:445:479; Interrogation_Position=753; Antisense; GTTTCTTTTTATTTGCCAGCTTGCA

Paste this into a BLAST search page for me
AATATCCAACGTCACTTAGCAAGTCAAAGCCCTAAATCTATCCGTGGAAGAGTGATGCCGAAAACCGAAATCCCAAAGATTGGCTGGAGGCATTTTTTCAATGGGTGCTCATCTGTTGACAATCCAATTGGATGCTATCCGTACGGAACTACGACTTCTGGCTGGACATCAATGAGGGCGAATTCATTTCTTTAGCAACGGGAATGAATCCACCCTTTTTGAAATTAGGCCTCAGGTGCAAATTCATCAGGGTGCAAATTCATCAGCGCTGTGTTCAGCGCTGTGTTCACTTACGTGGAGAAGTGCAGCGAACAGTTTCTTTTTAGTTTCTTTTTATTTGCCAGCTTGCA

Full Affymetrix probeset data:

Annotations for 1634808_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720