FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634811_at:

>probe:Drosophila_2:1634811_at:172:109; Interrogation_Position=116; Antisense; AGAAGAATCCATCTGCCATCATCTC
>probe:Drosophila_2:1634811_at:333:37; Interrogation_Position=133; Antisense; ATCATCTCGATCCTCTGTCCAGATG
>probe:Drosophila_2:1634811_at:542:597; Interrogation_Position=148; Antisense; TGTCCAGATGGCGATAAGCCCAATA
>probe:Drosophila_2:1634811_at:533:339; Interrogation_Position=15; Antisense; GCTAATCAGCTTAGAATCGCCCACT
>probe:Drosophila_2:1634811_at:271:327; Interrogation_Position=197; Antisense; GCGGGTCGGAAGAATTTCAGGCCAA
>probe:Drosophila_2:1634811_at:584:707; Interrogation_Position=212; Antisense; TTCAGGCCAAAGAATGTCCCCGAAC
>probe:Drosophila_2:1634811_at:239:389; Interrogation_Position=237; Antisense; GAAAAGCTTCAAGCCACCAGAAGAG
>probe:Drosophila_2:1634811_at:722:415; Interrogation_Position=277; Antisense; GAGCAGGAGGTGGTTCCCATTCTAA
>probe:Drosophila_2:1634811_at:649:367; Interrogation_Position=28; Antisense; GAATCGCCCACTGGTGGTCAGAGGA
>probe:Drosophila_2:1634811_at:600:453; Interrogation_Position=317; Antisense; GATTGGCCCGGGAAATGCCCCGCGA
>probe:Drosophila_2:1634811_at:702:449; Interrogation_Position=340; Antisense; GATCCCATCGGTTATCTGCAGAAGT
>probe:Drosophila_2:1634811_at:364:283; Interrogation_Position=355; Antisense; CTGCAGAAGTTTTGGCTTGACGACA
>probe:Drosophila_2:1634811_at:598:221; Interrogation_Position=385; Antisense; AAGTGTGACATTCCATTGCCGCAGA
>probe:Drosophila_2:1634811_at:401:73; Interrogation_Position=77; Antisense; AGGAAGTGCTCGGTTACGGCCACAG

Paste this into a BLAST search page for me
AGAAGAATCCATCTGCCATCATCTCATCATCTCGATCCTCTGTCCAGATGTGTCCAGATGGCGATAAGCCCAATAGCTAATCAGCTTAGAATCGCCCACTGCGGGTCGGAAGAATTTCAGGCCAATTCAGGCCAAAGAATGTCCCCGAACGAAAAGCTTCAAGCCACCAGAAGAGGAGCAGGAGGTGGTTCCCATTCTAAGAATCGCCCACTGGTGGTCAGAGGAGATTGGCCCGGGAAATGCCCCGCGAGATCCCATCGGTTATCTGCAGAAGTCTGCAGAAGTTTTGGCTTGACGACAAAGTGTGACATTCCATTGCCGCAGAAGGAAGTGCTCGGTTACGGCCACAG

Full Affymetrix probeset data:

Annotations for 1634811_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720