Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634812_at:

>probe:Drosophila_2:1634812_at:680:363; Interrogation_Position=1590; Antisense; GAATATTCGCTTCTGGATAGCAGTC
>probe:Drosophila_2:1634812_at:585:673; Interrogation_Position=1607; Antisense; TAGCAGTCAATCGATTGCGCCGTTC
>probe:Drosophila_2:1634812_at:239:433; Interrogation_Position=1672; Antisense; GAGGAGTTTTTGAAGCCCGGCGCAC
>probe:Drosophila_2:1634812_at:623:81; Interrogation_Position=1742; Antisense; AGGGCCTGAAGAATCCATCGCGGTT
>probe:Drosophila_2:1634812_at:274:541; Interrogation_Position=1763; Antisense; GGTTCACTTTTGACTCGGCATCGGA
>probe:Drosophila_2:1634812_at:481:393; Interrogation_Position=1812; Antisense; GAAAGATTGCTACCCGAGATTCATA
>probe:Drosophila_2:1634812_at:586:427; Interrogation_Position=1827; Antisense; GAGATTCATACGGTCGGAGCACTAC
>probe:Drosophila_2:1634812_at:112:553; Interrogation_Position=1842; Antisense; GGAGCACTACAAACGCCTGCTGGAC
>probe:Drosophila_2:1634812_at:139:155; Interrogation_Position=1875; Antisense; ACAGCCGTCGTACAAGAAGCGCTTT
>probe:Drosophila_2:1634812_at:72:373; Interrogation_Position=1890; Antisense; GAAGCGCTTTTTCAACTTTGGCGGC
>probe:Drosophila_2:1634812_at:205:569; Interrogation_Position=2005; Antisense; GGCAGTTCCATGATGCAGGCTCCAC
>probe:Drosophila_2:1634812_at:372:395; Interrogation_Position=2036; Antisense; GAAATCTTGCCCGTCGTCGTGGCAG
>probe:Drosophila_2:1634812_at:402:515; Interrogation_Position=2105; Antisense; GTGTGAACAAGGATGCCGGCTCCAA
>probe:Drosophila_2:1634812_at:507:99; Interrogation_Position=2150; Antisense; AGAGTAATCTCAGCGAAATCCCCTT

Paste this into a BLAST search page for me
GAATATTCGCTTCTGGATAGCAGTCTAGCAGTCAATCGATTGCGCCGTTCGAGGAGTTTTTGAAGCCCGGCGCACAGGGCCTGAAGAATCCATCGCGGTTGGTTCACTTTTGACTCGGCATCGGAGAAAGATTGCTACCCGAGATTCATAGAGATTCATACGGTCGGAGCACTACGGAGCACTACAAACGCCTGCTGGACACAGCCGTCGTACAAGAAGCGCTTTGAAGCGCTTTTTCAACTTTGGCGGCGGCAGTTCCATGATGCAGGCTCCACGAAATCTTGCCCGTCGTCGTGGCAGGTGTGAACAAGGATGCCGGCTCCAAAGAGTAATCTCAGCGAAATCCCCTT

Full Affymetrix probeset data:

Annotations for 1634812_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime