FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634814_at:

>probe:Drosophila_2:1634814_at:398:441; Interrogation_Position=1007; Antisense; GATGTGGCCACCAGTCTTGGAGCAC
>probe:Drosophila_2:1634814_at:307:553; Interrogation_Position=1025; Antisense; GGAGCACCCAATCGTATATTCTTCA
>probe:Drosophila_2:1634814_at:165:193; Interrogation_Position=1127; Antisense; AACTACTTTACACTTGGCATCGATG
>probe:Drosophila_2:1634814_at:624:619; Interrogation_Position=1152; Antisense; TGCTCTTTGATGCACGGACGCAGAC
>probe:Drosophila_2:1634814_at:591:395; Interrogation_Position=1183; Antisense; GAAATTCATTCTGCACACCAACTAC
>probe:Drosophila_2:1634814_at:115:1; Interrogation_Position=1207; Antisense; CCCCGGTCACTTCAACTTTAATATG
>probe:Drosophila_2:1634814_at:291:655; Interrogation_Position=1225; Antisense; TAATATGTACCATCGCTGCGAGTTC
>probe:Drosophila_2:1634814_at:143:71; Interrogation_Position=1263; Antisense; AGGCGGATCACCCTTCGATGAGTGA
>probe:Drosophila_2:1634814_at:606:259; Interrogation_Position=1295; Antisense; CACGATTTGGTGACGCCGACTAAGC
>probe:Drosophila_2:1634814_at:633:27; Interrogation_Position=1334; Antisense; ATAACCGCCTACACCAAATGGGACG
>probe:Drosophila_2:1634814_at:199:67; Interrogation_Position=1455; Antisense; ATGGCTACCAAGACCTGATTTTCGA
>probe:Drosophila_2:1634814_at:73:17; Interrogation_Position=1472; Antisense; ATTTTCGAGGTGATGCCCAATAGCC
>probe:Drosophila_2:1634814_at:728:537; Interrogation_Position=1507; Antisense; GGTAACGCTCTACAATACTGCGCCT
>probe:Drosophila_2:1634814_at:93:233; Interrogation_Position=1567; Antisense; AATGCAAGACATTCGCCTCACAGTG

Paste this into a BLAST search page for me
GATGTGGCCACCAGTCTTGGAGCACGGAGCACCCAATCGTATATTCTTCAAACTACTTTACACTTGGCATCGATGTGCTCTTTGATGCACGGACGCAGACGAAATTCATTCTGCACACCAACTACCCCCGGTCACTTCAACTTTAATATGTAATATGTACCATCGCTGCGAGTTCAGGCGGATCACCCTTCGATGAGTGACACGATTTGGTGACGCCGACTAAGCATAACCGCCTACACCAAATGGGACGATGGCTACCAAGACCTGATTTTCGAATTTTCGAGGTGATGCCCAATAGCCGGTAACGCTCTACAATACTGCGCCTAATGCAAGACATTCGCCTCACAGTG

Full Affymetrix probeset data:

Annotations for 1634814_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720