FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634816_at:

>probe:Drosophila_2:1634816_at:121:271; Interrogation_Position=1001; Antisense; CATCCATAATTTCTGCTTCTGCTTG
>probe:Drosophila_2:1634816_at:267:577; Interrogation_Position=1041; Antisense; GGCGCTTATTGCTTTATGGTTGTGT
>probe:Drosophila_2:1634816_at:179:643; Interrogation_Position=493; Antisense; TCTGCCTCCGGGACATTGTGGAACT
>probe:Drosophila_2:1634816_at:312:619; Interrogation_Position=538; Antisense; TGCTCTCCGGCGAATGTTTGGAACT
>probe:Drosophila_2:1634816_at:607:381; Interrogation_Position=558; Antisense; GAACTTTTGGCCAGTGATGCACCAG
>probe:Drosophila_2:1634816_at:492:129; Interrogation_Position=662; Antisense; ACCTCAGGTTTACGAACTGCTGGCC
>probe:Drosophila_2:1634816_at:593:513; Interrogation_Position=750; Antisense; GTGTATCGCGATCTGTATCTGGAGC
>probe:Drosophila_2:1634816_at:628:39; Interrogation_Position=792; Antisense; ATCTGCGGCCTGTTTGGCTACAATG
>probe:Drosophila_2:1634816_at:12:431; Interrogation_Position=816; Antisense; GAGTTTGTCAACTGGCGCAACGTAA
>probe:Drosophila_2:1634816_at:569:443; Interrogation_Position=885; Antisense; GATGTATTGGCTGACGACGGCGATA
>probe:Drosophila_2:1634816_at:270:575; Interrogation_Position=903; Antisense; GGCGATAGCCAGCACATAAGCGATT
>probe:Drosophila_2:1634816_at:718:205; Interrogation_Position=920; Antisense; AAGCGATTTGGCCTTGGTCTTCTAC
>probe:Drosophila_2:1634816_at:517:537; Interrogation_Position=935; Antisense; GGTCTTCTACACAAATGCACTGCTG
>probe:Drosophila_2:1634816_at:416:621; Interrogation_Position=961; Antisense; TGCTGCACTAATCCATCGAACATTC

Paste this into a BLAST search page for me
CATCCATAATTTCTGCTTCTGCTTGGGCGCTTATTGCTTTATGGTTGTGTTCTGCCTCCGGGACATTGTGGAACTTGCTCTCCGGCGAATGTTTGGAACTGAACTTTTGGCCAGTGATGCACCAGACCTCAGGTTTACGAACTGCTGGCCGTGTATCGCGATCTGTATCTGGAGCATCTGCGGCCTGTTTGGCTACAATGGAGTTTGTCAACTGGCGCAACGTAAGATGTATTGGCTGACGACGGCGATAGGCGATAGCCAGCACATAAGCGATTAAGCGATTTGGCCTTGGTCTTCTACGGTCTTCTACACAAATGCACTGCTGTGCTGCACTAATCCATCGAACATTC

Full Affymetrix probeset data:

Annotations for 1634816_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720