FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634819_at:

>probe:Drosophila_2:1634819_at:236:491; Interrogation_Position=111; Antisense; GTACAGCATCCAGACGCATCACGAG
>probe:Drosophila_2:1634819_at:248:71; Interrogation_Position=134; Antisense; AGGCGCCCAAGCAGTGGCAGGATCA
>probe:Drosophila_2:1634819_at:478:519; Interrogation_Position=181; Antisense; GTGGATGTCCCAAAGGCCCATTCAT
>probe:Drosophila_2:1634819_at:21:527; Interrogation_Position=207; Antisense; GGGCACAGTTCAGGATCATCACCAC
>probe:Drosophila_2:1634819_at:574:81; Interrogation_Position=272; Antisense; AGTGGAGCCACCACGAGGAACCCAA
>probe:Drosophila_2:1634819_at:101:615; Interrogation_Position=329; Antisense; TGAAGGACACCAAGACCGGCGACAT
>probe:Drosophila_2:1634819_at:265:33; Interrogation_Position=352; Antisense; ATCAAGCAGCAGTGGGAGACCCGCG
>probe:Drosophila_2:1634819_at:327:407; Interrogation_Position=418; Antisense; GACGGACGCACCAGGATCGTTGAGT
>probe:Drosophila_2:1634819_at:170:463; Interrogation_Position=464; Antisense; GATTCCAGGCAACCGTGAAGCATGT
>probe:Drosophila_2:1634819_at:620:377; Interrogation_Position=480; Antisense; GAAGCATGTGGGACACGCCAGTCAC
>probe:Drosophila_2:1634819_at:23:151; Interrogation_Position=503; Antisense; ACTTGGAGCACAGCCACTCATATGG
>probe:Drosophila_2:1634819_at:119:529; Interrogation_Position=51; Antisense; GGGAGTGGCTGCTGCTAGCTACATC
>probe:Drosophila_2:1634819_at:636:65; Interrogation_Position=548; Antisense; ATGGTCATGCCACCAGCTACGTGGA
>probe:Drosophila_2:1634819_at:595:675; Interrogation_Position=66; Antisense; TAGCTACATCCCTCATGGTGGATAT

Paste this into a BLAST search page for me
GTACAGCATCCAGACGCATCACGAGAGGCGCCCAAGCAGTGGCAGGATCAGTGGATGTCCCAAAGGCCCATTCATGGGCACAGTTCAGGATCATCACCACAGTGGAGCCACCACGAGGAACCCAATGAAGGACACCAAGACCGGCGACATATCAAGCAGCAGTGGGAGACCCGCGGACGGACGCACCAGGATCGTTGAGTGATTCCAGGCAACCGTGAAGCATGTGAAGCATGTGGGACACGCCAGTCACACTTGGAGCACAGCCACTCATATGGGGGAGTGGCTGCTGCTAGCTACATCATGGTCATGCCACCAGCTACGTGGATAGCTACATCCCTCATGGTGGATAT

Full Affymetrix probeset data:

Annotations for 1634819_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720