FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634820_at:

>probe:Drosophila_2:1634820_at:72:115; Interrogation_Position=385; Antisense; AGCGTTACCAGTTCAGCTACGGCGA
>probe:Drosophila_2:1634820_at:187:671; Interrogation_Position=402; Antisense; TACGGCGAGGTGATTCCCTGCGAGC
>probe:Drosophila_2:1634820_at:401:325; Interrogation_Position=445; Antisense; GCGACATCAAACAGGCGTACACTCA
>probe:Drosophila_2:1634820_at:77:217; Interrogation_Position=525; Antisense; AAGTACGGCTACCAACTGTACCAGT
>probe:Drosophila_2:1634820_at:69:563; Interrogation_Position=577; Antisense; GGAAGGCCACCTGTATTGGCAACAA
>probe:Drosophila_2:1634820_at:610:729; Interrogation_Position=592; Antisense; TTGGCAACAACTTCGGTGCCGCGAT
>probe:Drosophila_2:1634820_at:597:319; Interrogation_Position=609; Antisense; GCCGCGATCTCCATGCTGAAGCAGG
>probe:Drosophila_2:1634820_at:134:615; Interrogation_Position=655; Antisense; TGAAGCTGACGCTGGCGGACGCCAA
>probe:Drosophila_2:1634820_at:552:543; Interrogation_Position=680; Antisense; GGATTTGGCCATCAAGGTACTGAGC
>probe:Drosophila_2:1634820_at:601:77; Interrogation_Position=694; Antisense; AGGTACTGAGCATGACCCTGGACAC
>probe:Drosophila_2:1634820_at:34:111; Interrogation_Position=736; Antisense; AGAAGGTCGAGATGGCCACGCTGCA
>probe:Drosophila_2:1634820_at:660:211; Interrogation_Position=774; Antisense; AAGACCGTATACAGTGTCCTGGAGA
>probe:Drosophila_2:1634820_at:495:377; Interrogation_Position=878; Antisense; GAAGCAGCCGACCAAGTAATCCCAA
>probe:Drosophila_2:1634820_at:703:497; Interrogation_Position=926; Antisense; GTCTATCCTGATTTTTGTAACCGAT

Paste this into a BLAST search page for me
AGCGTTACCAGTTCAGCTACGGCGATACGGCGAGGTGATTCCCTGCGAGCGCGACATCAAACAGGCGTACACTCAAAGTACGGCTACCAACTGTACCAGTGGAAGGCCACCTGTATTGGCAACAATTGGCAACAACTTCGGTGCCGCGATGCCGCGATCTCCATGCTGAAGCAGGTGAAGCTGACGCTGGCGGACGCCAAGGATTTGGCCATCAAGGTACTGAGCAGGTACTGAGCATGACCCTGGACACAGAAGGTCGAGATGGCCACGCTGCAAAGACCGTATACAGTGTCCTGGAGAGAAGCAGCCGACCAAGTAATCCCAAGTCTATCCTGATTTTTGTAACCGAT

Full Affymetrix probeset data:

Annotations for 1634820_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720