Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634821_at:

>probe:Drosophila_2:1634821_at:558:87; Interrogation_Position=1229; Antisense; AGTCTAGGTACACGATGGCCATTAA
>probe:Drosophila_2:1634821_at:162:213; Interrogation_Position=1263; Antisense; AAGAGAGTTTCTGGAGGCCCTGAAC
>probe:Drosophila_2:1634821_at:574:519; Interrogation_Position=1303; Antisense; GTGGAGATCTATGACTACGGCAAAT
>probe:Drosophila_2:1634821_at:233:567; Interrogation_Position=1321; Antisense; GGCAAATTCTCTAAGCTGCGAAGCA
>probe:Drosophila_2:1634821_at:184:335; Interrogation_Position=1335; Antisense; GCTGCGAAGCACCTTTAATACCAAT
>probe:Drosophila_2:1634821_at:133:247; Interrogation_Position=1356; Antisense; CAATTATTTATTTCCGGTGACGGCT
>probe:Drosophila_2:1634821_at:272:611; Interrogation_Position=1373; Antisense; TGACGGCTTTGCAGTGGTTCACCAT
>probe:Drosophila_2:1634821_at:325:239; Interrogation_Position=1428; Antisense; AATCTTCTACTATTGCGATGCCTTT
>probe:Drosophila_2:1634821_at:705:445; Interrogation_Position=1444; Antisense; GATGCCTTTTGCCTTAATCAGTTTG
>probe:Drosophila_2:1634821_at:617:11; Interrogation_Position=1485; Antisense; ATTAAGACGTCATTTGCCCTATCGC
>probe:Drosophila_2:1634821_at:639:625; Interrogation_Position=1499; Antisense; TGCCCTATCGCGATATTTTCGAGGA
>probe:Drosophila_2:1634821_at:350:701; Interrogation_Position=1514; Antisense; TTTTCGAGGAGCACATGCTGCTGCA
>probe:Drosophila_2:1634821_at:524:171; Interrogation_Position=1615; Antisense; AAAGATTTCAGTCCGCTCCTAGAGA
>probe:Drosophila_2:1634821_at:576:237; Interrogation_Position=1660; Antisense; AATCTCTACTGGGTTTTCACCATGT

Paste this into a BLAST search page for me
AGTCTAGGTACACGATGGCCATTAAAAGAGAGTTTCTGGAGGCCCTGAACGTGGAGATCTATGACTACGGCAAATGGCAAATTCTCTAAGCTGCGAAGCAGCTGCGAAGCACCTTTAATACCAATCAATTATTTATTTCCGGTGACGGCTTGACGGCTTTGCAGTGGTTCACCATAATCTTCTACTATTGCGATGCCTTTGATGCCTTTTGCCTTAATCAGTTTGATTAAGACGTCATTTGCCCTATCGCTGCCCTATCGCGATATTTTCGAGGATTTTCGAGGAGCACATGCTGCTGCAAAAGATTTCAGTCCGCTCCTAGAGAAATCTCTACTGGGTTTTCACCATGT

Full Affymetrix probeset data:

Annotations for 1634821_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime