FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634823_at:

>probe:Drosophila_2:1634823_at:554:157; Interrogation_Position=119; Antisense; ACACATATGGTGCTCATCACGCGGG
>probe:Drosophila_2:1634823_at:119:47; Interrogation_Position=13; Antisense; ATGCCGTTCATGAAGGGCCGTGAGC
>probe:Drosophila_2:1634823_at:364:323; Interrogation_Position=143; Antisense; GCGCTCGGGACTTTGTTTTCTGGAA
>probe:Drosophila_2:1634823_at:703:151; Interrogation_Position=167; Antisense; ACATACCGCAGATCCAGTTCAAGAA
>probe:Drosophila_2:1634823_at:361:711; Interrogation_Position=184; Antisense; TTCAAGAATCCCGAGGTCCAGGTGC
>probe:Drosophila_2:1634823_at:153:505; Interrogation_Position=199; Antisense; GTCCAGGTGCTCACGCTGAAGAACA
>probe:Drosophila_2:1634823_at:450:597; Interrogation_Position=240; Antisense; TGTGCGCTGCTACTTCGACGATGGA
>probe:Drosophila_2:1634823_at:338:401; Interrogation_Position=304; Antisense; GACATCATCGATCACCTGGTTAAGG
>probe:Drosophila_2:1634823_at:472:175; Interrogation_Position=338; Antisense; AAACCCGGGAGCAACTGGACGCAGA
>probe:Drosophila_2:1634823_at:452:421; Interrogation_Position=378; Antisense; GAGCAAGGACAATCCGGCCAACTTT
>probe:Drosophila_2:1634823_at:247:115; Interrogation_Position=398; Antisense; ACTTTGGCTACGGATGCGGCAGGCA
>probe:Drosophila_2:1634823_at:104:301; Interrogation_Position=43; Antisense; CGCCGCACCCTGAAGTATCTGAATG
>probe:Drosophila_2:1634823_at:586:249; Interrogation_Position=492; Antisense; CAAGATCTTGTTCGCACCCAAATAG
>probe:Drosophila_2:1634823_at:93:81; Interrogation_Position=92; Antisense; AGGTGCGCATTTTCAGCGTGAACTA

Paste this into a BLAST search page for me
ACACATATGGTGCTCATCACGCGGGATGCCGTTCATGAAGGGCCGTGAGCGCGCTCGGGACTTTGTTTTCTGGAAACATACCGCAGATCCAGTTCAAGAATTCAAGAATCCCGAGGTCCAGGTGCGTCCAGGTGCTCACGCTGAAGAACATGTGCGCTGCTACTTCGACGATGGAGACATCATCGATCACCTGGTTAAGGAAACCCGGGAGCAACTGGACGCAGAGAGCAAGGACAATCCGGCCAACTTTACTTTGGCTACGGATGCGGCAGGCACGCCGCACCCTGAAGTATCTGAATGCAAGATCTTGTTCGCACCCAAATAGAGGTGCGCATTTTCAGCGTGAACTA

Full Affymetrix probeset data:

Annotations for 1634823_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720