Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634826_at:

>probe:Drosophila_2:1634826_at:642:381; Interrogation_Position=2182; Antisense; GAACGTATGGCTTGGATAACCTATA
>probe:Drosophila_2:1634826_at:570:263; Interrogation_Position=2217; Antisense; CAGACAGGTGGACAACTGCGCTTTT
>probe:Drosophila_2:1634826_at:31:145; Interrogation_Position=2231; Antisense; ACTGCGCTTTTAAGGAGCCCAAAAT
>probe:Drosophila_2:1634826_at:569:185; Interrogation_Position=2251; Antisense; AAAATATCATTGCTTGCCCAAGGAG
>probe:Drosophila_2:1634826_at:455:1; Interrogation_Position=2280; Antisense; GCTTAAAGGACCACGGCGGTCGTCA
>probe:Drosophila_2:1634826_at:667:225; Interrogation_Position=2304; Antisense; AAGGCCGCTTGTCCTTCAGTTGATG
>probe:Drosophila_2:1634826_at:240:727; Interrogation_Position=2323; Antisense; TTGATGCAGCGGATTTCCTACCCTA
>probe:Drosophila_2:1634826_at:81:461; Interrogation_Position=2370; Antisense; GATTTCTAGATTTTCAGACCAGGTA
>probe:Drosophila_2:1634826_at:617:535; Interrogation_Position=2391; Antisense; GGTAATCGACTGTAGCAACTGGGCT
>probe:Drosophila_2:1634826_at:625:261; Interrogation_Position=2448; Antisense; CACCTCGCACGACAGCAATGGAAAG
>probe:Drosophila_2:1634826_at:385:589; Interrogation_Position=2496; Antisense; TGGTACATTGATCACCTTTGACCCC
>probe:Drosophila_2:1634826_at:722:467; Interrogation_Position=2521; Antisense; GTTGCCTTTCTAGTAGACGCCCAGG
>probe:Drosophila_2:1634826_at:382:411; Interrogation_Position=2536; Antisense; GACGCCCAGGTCATCAGCATTGTTG
>probe:Drosophila_2:1634826_at:605:649; Interrogation_Position=2549; Antisense; TCAGCATTGTTGTCCATATTTCCTT

Paste this into a BLAST search page for me
GAACGTATGGCTTGGATAACCTATACAGACAGGTGGACAACTGCGCTTTTACTGCGCTTTTAAGGAGCCCAAAATAAAATATCATTGCTTGCCCAAGGAGGCTTAAAGGACCACGGCGGTCGTCAAAGGCCGCTTGTCCTTCAGTTGATGTTGATGCAGCGGATTTCCTACCCTAGATTTCTAGATTTTCAGACCAGGTAGGTAATCGACTGTAGCAACTGGGCTCACCTCGCACGACAGCAATGGAAAGTGGTACATTGATCACCTTTGACCCCGTTGCCTTTCTAGTAGACGCCCAGGGACGCCCAGGTCATCAGCATTGTTGTCAGCATTGTTGTCCATATTTCCTT

Full Affymetrix probeset data:

Annotations for 1634826_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime