FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634828_at:

>probe:Drosophila_2:1634828_at:25:177; Interrogation_Position=1636; Antisense; AAACGTTCATATATACCAGTGCCAT
>probe:Drosophila_2:1634828_at:13:559; Interrogation_Position=1670; Antisense; GGAAATCAGTTCTGGTCCTTCGACT
>probe:Drosophila_2:1634828_at:346:637; Interrogation_Position=1689; Antisense; TCGACTCCAAGACCCATCAGGTGAT
>probe:Drosophila_2:1634828_at:8:605; Interrogation_Position=1710; Antisense; TGATCTCCGGCCAACAGCAAAACTT
>probe:Drosophila_2:1634828_at:421:191; Interrogation_Position=1730; Antisense; AACTTCAGACATTGCCTGGAGGCCC
>probe:Drosophila_2:1634828_at:363:167; Interrogation_Position=1765; Antisense; AAATGCGGTTACTTCGAGTGTCTGT
>probe:Drosophila_2:1634828_at:678:433; Interrogation_Position=1780; Antisense; GAGTGTCTGTGATCCGAAGAACCAT
>probe:Drosophila_2:1634828_at:7:695; Interrogation_Position=1886; Antisense; TTTGCGGCATTGTCAACAGCTATGT
>probe:Drosophila_2:1634828_at:575:263; Interrogation_Position=1902; Antisense; CAGCTATGTCTATAACTGCCGAATA
>probe:Drosophila_2:1634828_at:256:657; Interrogation_Position=2021; Antisense; TAAAGACCCCTTCACGCAGTTTTAT
>probe:Drosophila_2:1634828_at:93:351; Interrogation_Position=2036; Antisense; GCAGTTTTATTTTCGAGTCCCATCC
>probe:Drosophila_2:1634828_at:674:431; Interrogation_Position=2050; Antisense; GAGTCCCATCCTTTCATTTTCAAAG
>probe:Drosophila_2:1634828_at:159:205; Interrogation_Position=2072; Antisense; AAGCCCAAGTTGAGCGGTACTCCAA
>probe:Drosophila_2:1634828_at:469:425; Interrogation_Position=2177; Antisense; GAGACCGGCAAGTTCATCTGAAATT

Paste this into a BLAST search page for me
AAACGTTCATATATACCAGTGCCATGGAAATCAGTTCTGGTCCTTCGACTTCGACTCCAAGACCCATCAGGTGATTGATCTCCGGCCAACAGCAAAACTTAACTTCAGACATTGCCTGGAGGCCCAAATGCGGTTACTTCGAGTGTCTGTGAGTGTCTGTGATCCGAAGAACCATTTTGCGGCATTGTCAACAGCTATGTCAGCTATGTCTATAACTGCCGAATATAAAGACCCCTTCACGCAGTTTTATGCAGTTTTATTTTCGAGTCCCATCCGAGTCCCATCCTTTCATTTTCAAAGAAGCCCAAGTTGAGCGGTACTCCAAGAGACCGGCAAGTTCATCTGAAATT

Full Affymetrix probeset data:

Annotations for 1634828_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720