FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634830_at:

>probe:Drosophila_2:1634830_at:113:659; Interrogation_Position=1486; Antisense; TAAGAACTTCTCACGCTCCATTGAT
>probe:Drosophila_2:1634830_at:68:453; Interrogation_Position=1508; Antisense; GATCAACATTTTATACCCTGGTCGT
>probe:Drosophila_2:1634830_at:279:683; Interrogation_Position=1519; Antisense; TATACCCTGGTCGTGGTGGACTTAT
>probe:Drosophila_2:1634830_at:530:551; Interrogation_Position=1544; Antisense; GGAGACTTCTGAGTTGTCCACGACC
>probe:Drosophila_2:1634830_at:402:505; Interrogation_Position=1559; Antisense; GTCCACGACCGCACGATGTATCGAT
>probe:Drosophila_2:1634830_at:501:67; Interrogation_Position=1582; Antisense; ATGGAAGCTCCATTGGGTCGATGTC
>probe:Drosophila_2:1634830_at:622:3; Interrogation_Position=1593; Antisense; ATTGGGTCGATGTCCCTTCGCGAAA
>probe:Drosophila_2:1634830_at:126:291; Interrogation_Position=1621; Antisense; CGTCCTCCAAGATCAAACCATCATT
>probe:Drosophila_2:1634830_at:21:255; Interrogation_Position=1652; Antisense; CAAAAGGCCCAGTTCCCATCTAAGG
>probe:Drosophila_2:1634830_at:255:39; Interrogation_Position=1669; Antisense; ATCTAAGGGCACCTAACCCTGTCAA
>probe:Drosophila_2:1634830_at:420:201; Interrogation_Position=1683; Antisense; AACCCTGTCAAATTTTGCCACGGCA
>probe:Drosophila_2:1634830_at:642:343; Interrogation_Position=1725; Antisense; GCTTGGTAACCATTCCGCAAATTAT
>probe:Drosophila_2:1634830_at:223:175; Interrogation_Position=1757; Antisense; AAAGCCATTTATTTTCTATCGACAT
>probe:Drosophila_2:1634830_at:392:543; Interrogation_Position=2013; Antisense; GGATTTATTTCCACTAGGGTCAATT

Paste this into a BLAST search page for me
TAAGAACTTCTCACGCTCCATTGATGATCAACATTTTATACCCTGGTCGTTATACCCTGGTCGTGGTGGACTTATGGAGACTTCTGAGTTGTCCACGACCGTCCACGACCGCACGATGTATCGATATGGAAGCTCCATTGGGTCGATGTCATTGGGTCGATGTCCCTTCGCGAAACGTCCTCCAAGATCAAACCATCATTCAAAAGGCCCAGTTCCCATCTAAGGATCTAAGGGCACCTAACCCTGTCAAAACCCTGTCAAATTTTGCCACGGCAGCTTGGTAACCATTCCGCAAATTATAAAGCCATTTATTTTCTATCGACATGGATTTATTTCCACTAGGGTCAATT

Full Affymetrix probeset data:

Annotations for 1634830_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720