FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634831_at:

>probe:Drosophila_2:1634831_at:224:191; Interrogation_Position=384; Antisense; AACATCATGGGCATCGTGCTGTGCA
>probe:Drosophila_2:1634831_at:297:217; Interrogation_Position=441; Antisense; AAGTTCGACGGCCATGTGGTGCTCA
>probe:Drosophila_2:1634831_at:46:519; Interrogation_Position=456; Antisense; GTGGTGCTCATCAATAGCATCCTGG
>probe:Drosophila_2:1634831_at:386:357; Interrogation_Position=482; Antisense; GCACAAGACCATGACGGCCACGGAG
>probe:Drosophila_2:1634831_at:340:63; Interrogation_Position=520; Antisense; ATGTGAACGTCTATCCGCCCAGCAA
>probe:Drosophila_2:1634831_at:151:209; Interrogation_Position=543; Antisense; AAGCATGCAGTTACAGCGCTGGCCG
>probe:Drosophila_2:1634831_at:673:223; Interrogation_Position=568; Antisense; AAGGATATCGCCAGGAGTTCTTCGG
>probe:Drosophila_2:1634831_at:293:95; Interrogation_Position=610; Antisense; AGATTACGAGCGTCAGTCCGGGCGT
>probe:Drosophila_2:1634831_at:16:261; Interrogation_Position=641; Antisense; CACGGAGATCGTGCCGGACAGCATT
>probe:Drosophila_2:1634831_at:384:223; Interrogation_Position=678; Antisense; AAGGATCGAATGCTCCACTCCGAGG
>probe:Drosophila_2:1634831_at:684:635; Interrogation_Position=706; Antisense; TCGCACAGGGAGTGCTGTACGCCAT
>probe:Drosophila_2:1634831_at:72:419; Interrogation_Position=759; Antisense; GAGCTGATCATCAAGCCACTTGGCG
>probe:Drosophila_2:1634831_at:14:117; Interrogation_Position=802; Antisense; AGCTTCAGGAGCTCTGTTCTTTTTT
>probe:Drosophila_2:1634831_at:71:693; Interrogation_Position=830; Antisense; TTTGTATTTTTCCTCTTCATCTTAA

Paste this into a BLAST search page for me
AACATCATGGGCATCGTGCTGTGCAAAGTTCGACGGCCATGTGGTGCTCAGTGGTGCTCATCAATAGCATCCTGGGCACAAGACCATGACGGCCACGGAGATGTGAACGTCTATCCGCCCAGCAAAAGCATGCAGTTACAGCGCTGGCCGAAGGATATCGCCAGGAGTTCTTCGGAGATTACGAGCGTCAGTCCGGGCGTCACGGAGATCGTGCCGGACAGCATTAAGGATCGAATGCTCCACTCCGAGGTCGCACAGGGAGTGCTGTACGCCATGAGCTGATCATCAAGCCACTTGGCGAGCTTCAGGAGCTCTGTTCTTTTTTTTTGTATTTTTCCTCTTCATCTTAA

Full Affymetrix probeset data:

Annotations for 1634831_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720