FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634834_at:

>probe:Drosophila_2:1634834_at:625:35; Interrogation_Position=158; Antisense; ATCAGGTGTCCATTCAGACCATCTG
>probe:Drosophila_2:1634834_at:357:585; Interrogation_Position=181; Antisense; TGGAAAACCCACATCTGCAGCGGAG
>probe:Drosophila_2:1634834_at:507:617; Interrogation_Position=196; Antisense; TGCAGCGGAGTCATTCTCAACGAAC
>probe:Drosophila_2:1634834_at:280:651; Interrogation_Position=230; Antisense; TCACCGCGGGTCATTGTGCACTGGA
>probe:Drosophila_2:1634834_at:604:355; Interrogation_Position=247; Antisense; GCACTGGACTTTAGCATCGAGGATC
>probe:Drosophila_2:1634834_at:587:399; Interrogation_Position=311; Antisense; GACAGACCTTATTTCCGGACGAGGC
>probe:Drosophila_2:1634834_at:703:137; Interrogation_Position=329; Antisense; ACGAGGCCCTAGTCCATTGCTTGTA
>probe:Drosophila_2:1634834_at:195:7; Interrogation_Position=344; Antisense; ATTGCTTGTACGACATACCCTATGT
>probe:Drosophila_2:1634834_at:209:45; Interrogation_Position=422; Antisense; ATCGCACCCAGATCGTTGAGTTGAG
>probe:Drosophila_2:1634834_at:357:393; Interrogation_Position=502; Antisense; GAAAGTAGCTATCCCACAGTGCAAT
>probe:Drosophila_2:1634834_at:288:85; Interrogation_Position=519; Antisense; AGTGCAATATCTGCAGACCCTCAAC
>probe:Drosophila_2:1634834_at:535:609; Interrogation_Position=545; Antisense; TGACCATCATCGCACACGAGGAGTG
>probe:Drosophila_2:1634834_at:157:63; Interrogation_Position=579; Antisense; ATGGGACTTTCACGATGGCATCGAC
>probe:Drosophila_2:1634834_at:20:497; Interrogation_Position=608; Antisense; GTCATATTTGCACCTTTACGCGAGA

Paste this into a BLAST search page for me
ATCAGGTGTCCATTCAGACCATCTGTGGAAAACCCACATCTGCAGCGGAGTGCAGCGGAGTCATTCTCAACGAACTCACCGCGGGTCATTGTGCACTGGAGCACTGGACTTTAGCATCGAGGATCGACAGACCTTATTTCCGGACGAGGCACGAGGCCCTAGTCCATTGCTTGTAATTGCTTGTACGACATACCCTATGTATCGCACCCAGATCGTTGAGTTGAGGAAAGTAGCTATCCCACAGTGCAATAGTGCAATATCTGCAGACCCTCAACTGACCATCATCGCACACGAGGAGTGATGGGACTTTCACGATGGCATCGACGTCATATTTGCACCTTTACGCGAGA

Full Affymetrix probeset data:

Annotations for 1634834_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720