FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634835_at:

>probe:Drosophila_2:1634835_at:317:727; Interrogation_Position=1016; Antisense; TTGTCGCTATTCGTATCGTGTGCCA
>probe:Drosophila_2:1634835_at:483:77; Interrogation_Position=1051; Antisense; AGGTTCCTTTGTGTGCGCCAAGTAC
>probe:Drosophila_2:1634835_at:645:437; Interrogation_Position=1106; Antisense; GAGGAATTCTCCTTGCGGTTGAAGA
>probe:Drosophila_2:1634835_at:298:615; Interrogation_Position=1125; Antisense; TGAAGAGCGGTCTGGTGCTCACCTA
>probe:Drosophila_2:1634835_at:553:129; Interrogation_Position=1145; Antisense; ACCTACTACGTCTGGGTGGTGGTCA
>probe:Drosophila_2:1634835_at:387:155; Interrogation_Position=1189; Antisense; ACACCAGAAGTTTTGCTTTCCCTTG
>probe:Drosophila_2:1634835_at:469:247; Interrogation_Position=675; Antisense; AATTGCCCGTCTGCATGGTGTACAA
>probe:Drosophila_2:1634835_at:99:515; Interrogation_Position=692; Antisense; GTGTACAACCTGGTGATGGCCATCA
>probe:Drosophila_2:1634835_at:359:483; Interrogation_Position=739; Antisense; GTATACCACCTGTAATGCCTTCAAC
>probe:Drosophila_2:1634835_at:145:257; Interrogation_Position=802; Antisense; CAAAGTGTGGGCTCTGGCTTGCTAC
>probe:Drosophila_2:1634835_at:16:589; Interrogation_Position=828; Antisense; TGGAGTTCCCATTTCTCATTGCCAG
>probe:Drosophila_2:1634835_at:91:619; Interrogation_Position=853; Antisense; TGCATGGCTGCAGTTCCGATTCTAT
>probe:Drosophila_2:1634835_at:451:91; Interrogation_Position=941; Antisense; AGTAGTTCCAGCGTACTGCTATGGG
>probe:Drosophila_2:1634835_at:639:99; Interrogation_Position=979; Antisense; AGAGGATGGCGACTCATTGCTGCAC

Paste this into a BLAST search page for me
TTGTCGCTATTCGTATCGTGTGCCAAGGTTCCTTTGTGTGCGCCAAGTACGAGGAATTCTCCTTGCGGTTGAAGATGAAGAGCGGTCTGGTGCTCACCTAACCTACTACGTCTGGGTGGTGGTCAACACCAGAAGTTTTGCTTTCCCTTGAATTGCCCGTCTGCATGGTGTACAAGTGTACAACCTGGTGATGGCCATCAGTATACCACCTGTAATGCCTTCAACCAAAGTGTGGGCTCTGGCTTGCTACTGGAGTTCCCATTTCTCATTGCCAGTGCATGGCTGCAGTTCCGATTCTATAGTAGTTCCAGCGTACTGCTATGGGAGAGGATGGCGACTCATTGCTGCAC

Full Affymetrix probeset data:

Annotations for 1634835_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720