FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634839_at:

>probe:Drosophila_2:1634839_at:351:501; Interrogation_Position=287; Antisense; GTCGATCATCGGGAGAACGCCACGG
>probe:Drosophila_2:1634839_at:336:201; Interrogation_Position=302; Antisense; AACGCCACGGCGCAGCAGGAAAAGA
>probe:Drosophila_2:1634839_at:569:447; Interrogation_Position=333; Antisense; GATGCCTGAAGTTCGGTGGTTCCAC
>probe:Drosophila_2:1634839_at:16:515; Interrogation_Position=395; Antisense; GTGTTTGCCGACATCGAGTGCTACG
>probe:Drosophila_2:1634839_at:214:433; Interrogation_Position=410; Antisense; GAGTGCTACGGTAATCGCACCTTTC
>probe:Drosophila_2:1634839_at:230:513; Interrogation_Position=479; Antisense; GTGACCACACTGATCTACAGCATGC
>probe:Drosophila_2:1634839_at:5:53; Interrogation_Position=500; Antisense; ATGCTGCTGGGTTTCCTCGGTATGG
>probe:Drosophila_2:1634839_at:224:681; Interrogation_Position=520; Antisense; TATGGATCGCTTCTGTCTCGGTCAA
>probe:Drosophila_2:1634839_at:208:359; Interrogation_Position=561; Antisense; GCAAACTGCTTACCATGGGCGGCGT
>probe:Drosophila_2:1634839_at:389:327; Interrogation_Position=588; Antisense; GCGTTTGGTGGATCATCGACGTCAT
>probe:Drosophila_2:1634839_at:149:605; Interrogation_Position=618; Antisense; TGATCACCAACAATTTGCTGCCCGA
>probe:Drosophila_2:1634839_at:598:729; Interrogation_Position=655; Antisense; TTGGAATCCCTATGTCTAGACGTGT
>probe:Drosophila_2:1634839_at:457:139; Interrogation_Position=674; Antisense; ACGTGTGTGATATGCCTCTGTGTCA
>probe:Drosophila_2:1634839_at:283:13; Interrogation_Position=764; Antisense; ATTAACTTGCCCCTTATTTCATTAT

Paste this into a BLAST search page for me
GTCGATCATCGGGAGAACGCCACGGAACGCCACGGCGCAGCAGGAAAAGAGATGCCTGAAGTTCGGTGGTTCCACGTGTTTGCCGACATCGAGTGCTACGGAGTGCTACGGTAATCGCACCTTTCGTGACCACACTGATCTACAGCATGCATGCTGCTGGGTTTCCTCGGTATGGTATGGATCGCTTCTGTCTCGGTCAAGCAAACTGCTTACCATGGGCGGCGTGCGTTTGGTGGATCATCGACGTCATTGATCACCAACAATTTGCTGCCCGATTGGAATCCCTATGTCTAGACGTGTACGTGTGTGATATGCCTCTGTGTCAATTAACTTGCCCCTTATTTCATTAT

Full Affymetrix probeset data:

Annotations for 1634839_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720