FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634840_at:

>probe:Drosophila_2:1634840_at:437:685; Interrogation_Position=105; Antisense; TATCTTGACCTTGGCCGTGGTTGGC
>probe:Drosophila_2:1634840_at:594:515; Interrogation_Position=131; Antisense; GTGTGGCCGCCGAATCTGGCTACAA
>probe:Drosophila_2:1634840_at:191:41; Interrogation_Position=144; Antisense; ATCTGGCTACAACTACAATGCTCCC
>probe:Drosophila_2:1634840_at:269:603; Interrogation_Position=198; Antisense; TGTTTTCCAGCAAGCTGCCTCTGCT
>probe:Drosophila_2:1634840_at:216:631; Interrogation_Position=222; Antisense; TCCGGCTCCAGTGAGGACCTACGTG
>probe:Drosophila_2:1634840_at:490:91; Interrogation_Position=43; Antisense; AGATTCTCCGACTTGTATAAAAGTA
>probe:Drosophila_2:1634840_at:567:617; Interrogation_Position=492; Antisense; TGCTTTCGAGTCCTCCGGACCGGTG
>probe:Drosophila_2:1634840_at:479:411; Interrogation_Position=509; Antisense; GACCGGTGTTCGAGGCCGCAGCTTC
>probe:Drosophila_2:1634840_at:71:545; Interrogation_Position=556; Antisense; GGATACGATTATAGCCAGCCCGCCG
>probe:Drosophila_2:1634840_at:224:321; Interrogation_Position=577; Antisense; GCCGCCAGCCAGCAGGGATACAAGT
>probe:Drosophila_2:1634840_at:360:303; Interrogation_Position=618; Antisense; CCGTGTGTTCAAGCACCGCGCTTAA
>probe:Drosophila_2:1634840_at:392:171; Interrogation_Position=62; Antisense; AAAGTACAGGAGTCGCCGGTCTAAG
>probe:Drosophila_2:1634840_at:721:431; Interrogation_Position=71; Antisense; GAGTCGCCGGTCTAAGATATTATTC
>probe:Drosophila_2:1634840_at:46:161; Interrogation_Position=97; Antisense; AAATTCTTTATCTTGACCTTGGCCG

Paste this into a BLAST search page for me
TATCTTGACCTTGGCCGTGGTTGGCGTGTGGCCGCCGAATCTGGCTACAAATCTGGCTACAACTACAATGCTCCCTGTTTTCCAGCAAGCTGCCTCTGCTTCCGGCTCCAGTGAGGACCTACGTGAGATTCTCCGACTTGTATAAAAGTATGCTTTCGAGTCCTCCGGACCGGTGGACCGGTGTTCGAGGCCGCAGCTTCGGATACGATTATAGCCAGCCCGCCGGCCGCCAGCCAGCAGGGATACAAGTCCGTGTGTTCAAGCACCGCGCTTAAAAAGTACAGGAGTCGCCGGTCTAAGGAGTCGCCGGTCTAAGATATTATTCAAATTCTTTATCTTGACCTTGGCCG

Full Affymetrix probeset data:

Annotations for 1634840_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720