FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634843_at:

>probe:Drosophila_2:1634843_at:477:479; Interrogation_Position=341; Antisense; TGAAATAGCTTATACCCCAAACCGA
>probe:Drosophila_2:1634843_at:209:533; Interrogation_Position=371; Antisense; GGTCAGCAGTCCAGTTAACGATGGG
>probe:Drosophila_2:1634843_at:175:435; Interrogation_Position=451; Antisense; GAGGGAATTCACCATCGCGGGTTAC
>probe:Drosophila_2:1634843_at:380:541; Interrogation_Position=470; Antisense; GGTTACAGCACAGCCTCAAGCTCAA
>probe:Drosophila_2:1634843_at:680:47; Interrogation_Position=501; Antisense; ATCCTGCTGATCGTAGTCAACAAGA
>probe:Drosophila_2:1634843_at:153:449; Interrogation_Position=528; Antisense; GATCCACCACCGTATGGCCAAGGAC
>probe:Drosophila_2:1634843_at:258:243; Interrogation_Position=577; Antisense; AATATTCAGTTCCTGGACCCAGAGG
>probe:Drosophila_2:1634843_at:67:79; Interrogation_Position=695; Antisense; AGGATATCCTGGTCAGGGACCCAGA
>probe:Drosophila_2:1634843_at:6:109; Interrogation_Position=717; Antisense; AGAAGATATTCTTGTCCGGGACCCA
>probe:Drosophila_2:1634843_at:661:631; Interrogation_Position=755; Antisense; TCCGGGATCTAGTGGTCGGCCAGAT
>probe:Drosophila_2:1634843_at:453:289; Interrogation_Position=781; Antisense; CGGGCGGTGGACTACAAGGCTATTA
>probe:Drosophila_2:1634843_at:354:251; Interrogation_Position=795; Antisense; CAAGGCTATTATTACCCACCGTCCG
>probe:Drosophila_2:1634843_at:247:305; Interrogation_Position=813; Antisense; CCGTCCGGTCCTGGAAATGGAACAG
>probe:Drosophila_2:1634843_at:290:563; Interrogation_Position=846; Antisense; GGAAGACCAAGACCCCAGAATGAGA

Paste this into a BLAST search page for me
TGAAATAGCTTATACCCCAAACCGAGGTCAGCAGTCCAGTTAACGATGGGGAGGGAATTCACCATCGCGGGTTACGGTTACAGCACAGCCTCAAGCTCAAATCCTGCTGATCGTAGTCAACAAGAGATCCACCACCGTATGGCCAAGGACAATATTCAGTTCCTGGACCCAGAGGAGGATATCCTGGTCAGGGACCCAGAAGAAGATATTCTTGTCCGGGACCCATCCGGGATCTAGTGGTCGGCCAGATCGGGCGGTGGACTACAAGGCTATTACAAGGCTATTATTACCCACCGTCCGCCGTCCGGTCCTGGAAATGGAACAGGGAAGACCAAGACCCCAGAATGAGA

Full Affymetrix probeset data:

Annotations for 1634843_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720