Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634844_at:

>probe:Drosophila_2:1634844_at:127:455; Interrogation_Position=1015; Antisense; GATAAGCCAGTGTTCGCCAAGCTGT
>probe:Drosophila_2:1634844_at:646:309; Interrogation_Position=1030; Antisense; GCCAAGCTGTGATCGGTAACCTGTA
>probe:Drosophila_2:1634844_at:364:641; Interrogation_Position=1121; Antisense; TCTGCCTTTACTTTAGGACCCAAAT
>probe:Drosophila_2:1634844_at:438:553; Interrogation_Position=627; Antisense; GGACGCCTTTTTCCAGGTCAAGGAG
>probe:Drosophila_2:1634844_at:454:225; Interrogation_Position=700; Antisense; AAGGCAGTGGGCAGTCAGTCCCTCG
>probe:Drosophila_2:1634844_at:551:417; Interrogation_Position=730; Antisense; GAGCTGTGCTTCACTGGGCGCAAAT
>probe:Drosophila_2:1634844_at:344:397; Interrogation_Position=805; Antisense; GACAAGGATTCCCTGCTGACCGGAG
>probe:Drosophila_2:1634844_at:29:523; Interrogation_Position=838; Antisense; GTGGCCGAGCTCATCGCTAGCAAGA
>probe:Drosophila_2:1634844_at:427:109; Interrogation_Position=856; Antisense; AGCAAGAGTCCCGTCGCCGTAAAGA
>probe:Drosophila_2:1634844_at:205:77; Interrogation_Position=887; Antisense; AGGAGAGCCTCGTGTACTCCCTGGA
>probe:Drosophila_2:1634844_at:669:213; Interrogation_Position=923; Antisense; AAGAGGGCTTGGATCACATTCTCCT
>probe:Drosophila_2:1634844_at:235:151; Interrogation_Position=938; Antisense; ACATTCTCCTGCTGAACAAGCTCAA
>probe:Drosophila_2:1634844_at:38:161; Interrogation_Position=953; Antisense; ACAAGCTCAACCTGCTGTCGGAGGA
>probe:Drosophila_2:1634844_at:110:537; Interrogation_Position=993; Antisense; GGCCGCCCAGTTGACGAAGGACGAT

Paste this into a BLAST search page for me
GATAAGCCAGTGTTCGCCAAGCTGTGCCAAGCTGTGATCGGTAACCTGTATCTGCCTTTACTTTAGGACCCAAATGGACGCCTTTTTCCAGGTCAAGGAGAAGGCAGTGGGCAGTCAGTCCCTCGGAGCTGTGCTTCACTGGGCGCAAATGACAAGGATTCCCTGCTGACCGGAGGTGGCCGAGCTCATCGCTAGCAAGAAGCAAGAGTCCCGTCGCCGTAAAGAAGGAGAGCCTCGTGTACTCCCTGGAAAGAGGGCTTGGATCACATTCTCCTACATTCTCCTGCTGAACAAGCTCAAACAAGCTCAACCTGCTGTCGGAGGAGGCCGCCCAGTTGACGAAGGACGAT

Full Affymetrix probeset data:

Annotations for 1634844_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime