FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634845_at:

>probe:Drosophila_2:1634845_at:542:317; Interrogation_Position=1002; Antisense; GCCTGTGCAACAGCATTCGCAACGA
>probe:Drosophila_2:1634845_at:62:447; Interrogation_Position=1025; Antisense; GATGCTCGACGTTCTTACTTTTAGA
>probe:Drosophila_2:1634845_at:309:287; Interrogation_Position=1073; Antisense; CTGGGATTGGCAGTCGACTTGTTAA
>probe:Drosophila_2:1634845_at:556:273; Interrogation_Position=1132; Antisense; CTTGGCAGGTCTTGAGCGTTATTCA
>probe:Drosophila_2:1634845_at:656:153; Interrogation_Position=1208; Antisense; ACAGTGCACTGAAATGATCCCTTTT
>probe:Drosophila_2:1634845_at:656:13; Interrogation_Position=1224; Antisense; ATCCCTTTTCACACGTTGATTTCAG
>probe:Drosophila_2:1634845_at:30:87; Interrogation_Position=783; Antisense; AGTGCTGCGGTCGTGGAAGTCCCCA
>probe:Drosophila_2:1634845_at:134:373; Interrogation_Position=798; Antisense; GAAGTCCCCAGGATTACATCGTCAA
>probe:Drosophila_2:1634845_at:472:625; Interrogation_Position=831; Antisense; TGCCGCCGGAGACATGTTTCCGAAA
>probe:Drosophila_2:1634845_at:506:551; Interrogation_Position=874; Antisense; GGAGAACCTGATCCACACCGGCTGT
>probe:Drosophila_2:1634845_at:478:427; Interrogation_Position=905; Antisense; GAGTTCGAGAACTACTGGCAACACT
>probe:Drosophila_2:1634845_at:56:217; Interrogation_Position=935; Antisense; AAGATTTTTAACATCCTGGCCCTCG
>probe:Drosophila_2:1634845_at:552:487; Interrogation_Position=959; Antisense; GTACTCATTGGCTTCGAGCTCCTGC
>probe:Drosophila_2:1634845_at:378:419; Interrogation_Position=974; Antisense; GAGCTCCTGCTGAGTGTCATCTCTT

Paste this into a BLAST search page for me
GCCTGTGCAACAGCATTCGCAACGAGATGCTCGACGTTCTTACTTTTAGACTGGGATTGGCAGTCGACTTGTTAACTTGGCAGGTCTTGAGCGTTATTCAACAGTGCACTGAAATGATCCCTTTTATCCCTTTTCACACGTTGATTTCAGAGTGCTGCGGTCGTGGAAGTCCCCAGAAGTCCCCAGGATTACATCGTCAATGCCGCCGGAGACATGTTTCCGAAAGGAGAACCTGATCCACACCGGCTGTGAGTTCGAGAACTACTGGCAACACTAAGATTTTTAACATCCTGGCCCTCGGTACTCATTGGCTTCGAGCTCCTGCGAGCTCCTGCTGAGTGTCATCTCTT

Full Affymetrix probeset data:

Annotations for 1634845_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720