FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634847_at:

>probe:Drosophila_2:1634847_at:98:87; Interrogation_Position=1403; Antisense; AGTCCAGTATCTATGTGTCCCAGGG
>probe:Drosophila_2:1634847_at:276:81; Interrogation_Position=1424; Antisense; AGGGAACTGGAATTGCCACACCATC
>probe:Drosophila_2:1634847_at:225:615; Interrogation_Position=1502; Antisense; TGAAGCAATTGAATCTGCCGCCTCC
>probe:Drosophila_2:1634847_at:289:253; Interrogation_Position=1558; Antisense; CAAGCTCTTGTGGACGCGGGATATC
>probe:Drosophila_2:1634847_at:338:457; Interrogation_Position=1577; Antisense; GATATCCAGTGAAGGCAGTGCCCGT
>probe:Drosophila_2:1634847_at:71:93; Interrogation_Position=1605; Antisense; AGTTCCCGTTCCGTATGAGCAGTAC
>probe:Drosophila_2:1634847_at:84:79; Interrogation_Position=1634; Antisense; AGGATCATCCGGAGTACCGCAATCA
>probe:Drosophila_2:1634847_at:88:601; Interrogation_Position=1665; Antisense; TGTAGACTACGCTCACATCATGCGC
>probe:Drosophila_2:1634847_at:242:261; Interrogation_Position=1695; Antisense; CACGCGGCAATTGGCTGCACATCAG
>probe:Drosophila_2:1634847_at:384:413; Interrogation_Position=1747; Antisense; GAGCCGTCGGTCAAGATCCTGTCCA
>probe:Drosophila_2:1634847_at:591:269; Interrogation_Position=1812; Antisense; CATCGGCGGCGGTAGTATCACGTAT
>probe:Drosophila_2:1634847_at:648:681; Interrogation_Position=1827; Antisense; TATCACGTATTTGCAACCCATCGAG
>probe:Drosophila_2:1634847_at:14:323; Interrogation_Position=1876; Antisense; GCCCATGTCCATGCGTTGCAGAAGA
>probe:Drosophila_2:1634847_at:522:103; Interrogation_Position=1903; Antisense; AGACCGCGTGATGAGCAGGATACCG

Paste this into a BLAST search page for me
AGTCCAGTATCTATGTGTCCCAGGGAGGGAACTGGAATTGCCACACCATCTGAAGCAATTGAATCTGCCGCCTCCCAAGCTCTTGTGGACGCGGGATATCGATATCCAGTGAAGGCAGTGCCCGTAGTTCCCGTTCCGTATGAGCAGTACAGGATCATCCGGAGTACCGCAATCATGTAGACTACGCTCACATCATGCGCCACGCGGCAATTGGCTGCACATCAGGAGCCGTCGGTCAAGATCCTGTCCACATCGGCGGCGGTAGTATCACGTATTATCACGTATTTGCAACCCATCGAGGCCCATGTCCATGCGTTGCAGAAGAAGACCGCGTGATGAGCAGGATACCG

Full Affymetrix probeset data:

Annotations for 1634847_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720