FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634848_at:

>probe:Drosophila_2:1634848_at:314:585; Interrogation_Position=1005; Antisense; TGGACGATTCTCAGATGTGTGCCGG
>probe:Drosophila_2:1634848_at:592:691; Interrogation_Position=1077; Antisense; TTATGGTGCCTATATCCACGGGCGG
>probe:Drosophila_2:1634848_at:516:441; Interrogation_Position=1106; Antisense; GATGTCTTCTACATTGCCGGCGTCA
>probe:Drosophila_2:1634848_at:482:445; Interrogation_Position=670; Antisense; GATGAACGGACAGCGCATCTGTGCA
>probe:Drosophila_2:1634848_at:64:271; Interrogation_Position=730; Antisense; CATCCACGAGATGTATGCTCCCAAT
>probe:Drosophila_2:1634848_at:407:631; Interrogation_Position=748; Antisense; TCCCAATTCCGTTGATCAGCGTAAT
>probe:Drosophila_2:1634848_at:606:231; Interrogation_Position=770; Antisense; AATGACATTGCGTTGGTGCGCCTTA
>probe:Drosophila_2:1634848_at:78:543; Interrogation_Position=798; Antisense; GGATTGTTAGCTACACCGACTACGT
>probe:Drosophila_2:1634848_at:27:405; Interrogation_Position=815; Antisense; GACTACGTGCGTCCAATATGCCTTC
>probe:Drosophila_2:1634848_at:200:23; Interrogation_Position=830; Antisense; ATATGCCTTCCCACGGATGGTTTAG
>probe:Drosophila_2:1634848_at:430:159; Interrogation_Position=861; Antisense; ACAACTTTGTGGACTACGGCATGGA
>probe:Drosophila_2:1634848_at:302:557; Interrogation_Position=899; Antisense; GGACTTACCGAGAACATGCAGCCAA
>probe:Drosophila_2:1634848_at:533:451; Interrogation_Position=940; Antisense; GATCACCGTCAACGTTTGGAACCTA
>probe:Drosophila_2:1634848_at:501:387; Interrogation_Position=977; Antisense; GAAAAGTACTCCAGCTTCAAGGTGA

Paste this into a BLAST search page for me
TGGACGATTCTCAGATGTGTGCCGGTTATGGTGCCTATATCCACGGGCGGGATGTCTTCTACATTGCCGGCGTCAGATGAACGGACAGCGCATCTGTGCACATCCACGAGATGTATGCTCCCAATTCCCAATTCCGTTGATCAGCGTAATAATGACATTGCGTTGGTGCGCCTTAGGATTGTTAGCTACACCGACTACGTGACTACGTGCGTCCAATATGCCTTCATATGCCTTCCCACGGATGGTTTAGACAACTTTGTGGACTACGGCATGGAGGACTTACCGAGAACATGCAGCCAAGATCACCGTCAACGTTTGGAACCTAGAAAAGTACTCCAGCTTCAAGGTGA

Full Affymetrix probeset data:

Annotations for 1634848_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720