FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634849_at:

>probe:Drosophila_2:1634849_at:689:177; Interrogation_Position=1801; Antisense; AAACTGGGCCAATAGACCGCTGCGT
>probe:Drosophila_2:1634849_at:242:329; Interrogation_Position=1822; Antisense; GCGTCGCGAGCAGATTCTTTATGCA
>probe:Drosophila_2:1634849_at:343:699; Interrogation_Position=1839; Antisense; TTTATGCAGCCATCGATGCGCGGTG
>probe:Drosophila_2:1634849_at:14:51; Interrogation_Position=1854; Antisense; ATGCGCGGTGTTTGATGCTGATCTA
>probe:Drosophila_2:1634849_at:542:621; Interrogation_Position=1869; Antisense; TGCTGATCTACAACACGCTCATTGA
>probe:Drosophila_2:1634849_at:635:329; Interrogation_Position=1896; Antisense; GCGTGTCCTTCATACAAGCGGTTAT
>probe:Drosophila_2:1634849_at:327:347; Interrogation_Position=1929; Antisense; GCATCGCCAGCAATAACTTTCTCAG
>probe:Drosophila_2:1634849_at:626:75; Interrogation_Position=1979; Antisense; AGGAGCTGGCCTCTGTTATACCCAT
>probe:Drosophila_2:1634849_at:598:269; Interrogation_Position=2001; Antisense; CATGCTCCTTTTGATGGATAGCGAT
>probe:Drosophila_2:1634849_at:352:71; Interrogation_Position=2043; Antisense; AGGCGTTCGCCCAACATTTATTAAG
>probe:Drosophila_2:1634849_at:102:689; Interrogation_Position=2107; Antisense; TATTTAGTGACTAGCCAGGCAGCTG
>probe:Drosophila_2:1634849_at:234:319; Interrogation_Position=2139; Antisense; GCCGAGTTAGGCAGTTTGTACACAT
>probe:Drosophila_2:1634849_at:385:561; Interrogation_Position=2178; Antisense; GGAAACTATGTGACTGCGAGCAGGA
>probe:Drosophila_2:1634849_at:70:19; Interrogation_Position=2232; Antisense; ATTTCAAGCTCACTGTATCTCCATA

Paste this into a BLAST search page for me
AAACTGGGCCAATAGACCGCTGCGTGCGTCGCGAGCAGATTCTTTATGCATTTATGCAGCCATCGATGCGCGGTGATGCGCGGTGTTTGATGCTGATCTATGCTGATCTACAACACGCTCATTGAGCGTGTCCTTCATACAAGCGGTTATGCATCGCCAGCAATAACTTTCTCAGAGGAGCTGGCCTCTGTTATACCCATCATGCTCCTTTTGATGGATAGCGATAGGCGTTCGCCCAACATTTATTAAGTATTTAGTGACTAGCCAGGCAGCTGGCCGAGTTAGGCAGTTTGTACACATGGAAACTATGTGACTGCGAGCAGGAATTTCAAGCTCACTGTATCTCCATA

Full Affymetrix probeset data:

Annotations for 1634849_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720