FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634852_at:

>probe:Drosophila_2:1634852_at:420:131; Interrogation_Position=103; Antisense; ACCGTCACTGGATGCATCAACTGCA
>probe:Drosophila_2:1634852_at:454:425; Interrogation_Position=15; Antisense; GAGAGCAGCAACTATCATCTTCGCC
>probe:Drosophila_2:1634852_at:504:83; Interrogation_Position=192; Antisense; AGTGGCTCCAGCAACGAGCACCGTT
>probe:Drosophila_2:1634852_at:516:143; Interrogation_Position=229; Antisense; ACTGCGCCAACGACATCAAGCGGAA
>probe:Drosophila_2:1634852_at:422:561; Interrogation_Position=262; Antisense; GGAAGCCGAAAGATCGTCCGCGTTA
>probe:Drosophila_2:1634852_at:22:215; Interrogation_Position=271; Antisense; AAGATCGTCCGCGTTAGCAACCTGC
>probe:Drosophila_2:1634852_at:101:495; Interrogation_Position=304; Antisense; GTCAACCGTCGCATTCGGATCAACA
>probe:Drosophila_2:1634852_at:472:11; Interrogation_Position=316; Antisense; ATTCGGATCAACACCACCGCTCGAT
>probe:Drosophila_2:1634852_at:676:189; Interrogation_Position=385; Antisense; AACAGGAACCGCAGGCGCAGGAATA
>probe:Drosophila_2:1634852_at:330:295; Interrogation_Position=400; Antisense; CGCAGGAATAACAACGCCAGGCAAG
>probe:Drosophila_2:1634852_at:668:313; Interrogation_Position=415; Antisense; GCCAGGCAAGGCAACTCCAGGAGCA
>probe:Drosophila_2:1634852_at:692:359; Interrogation_Position=425; Antisense; GCAACTCCAGGAGCAGTCGCGGAAA
>probe:Drosophila_2:1634852_at:587:349; Interrogation_Position=437; Antisense; GCAGTCGCGGAAACGTTCGCGTAGT
>probe:Drosophila_2:1634852_at:552:287; Interrogation_Position=49; Antisense; CTGGCAGCCTGCCTATTGAGGAGCA

Paste this into a BLAST search page for me
ACCGTCACTGGATGCATCAACTGCAGAGAGCAGCAACTATCATCTTCGCCAGTGGCTCCAGCAACGAGCACCGTTACTGCGCCAACGACATCAAGCGGAAGGAAGCCGAAAGATCGTCCGCGTTAAAGATCGTCCGCGTTAGCAACCTGCGTCAACCGTCGCATTCGGATCAACAATTCGGATCAACACCACCGCTCGATAACAGGAACCGCAGGCGCAGGAATACGCAGGAATAACAACGCCAGGCAAGGCCAGGCAAGGCAACTCCAGGAGCAGCAACTCCAGGAGCAGTCGCGGAAAGCAGTCGCGGAAACGTTCGCGTAGTCTGGCAGCCTGCCTATTGAGGAGCA

Full Affymetrix probeset data:

Annotations for 1634852_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720