FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634853_at:

>probe:Drosophila_2:1634853_at:634:573; Interrogation_Position=2749; Antisense; GGCTGTGGACGGACTTTTGTAAACA
>probe:Drosophila_2:1634853_at:153:179; Interrogation_Position=2760; Antisense; GACTTTTGTAAACAGTTCCCAGTTG
>probe:Drosophila_2:1634853_at:93:719; Interrogation_Position=2775; Antisense; TTCCCAGTTGAATGTGCATGTCCGA
>probe:Drosophila_2:1634853_at:126:503; Interrogation_Position=2794; Antisense; GTCCGAAAGATTCACGATGGCATCA
>probe:Drosophila_2:1634853_at:512:583; Interrogation_Position=2811; Antisense; TGGCATCATTTTGCTCCAGGAGGAT
>probe:Drosophila_2:1634853_at:361:549; Interrogation_Position=2844; Antisense; GGAGGACGAATACATCACCGATGAT
>probe:Drosophila_2:1634853_at:638:47; Interrogation_Position=2874; Antisense; ATCCACATCTAAAAAGCGCCGCCTA
>probe:Drosophila_2:1634853_at:290:205; Interrogation_Position=2887; Antisense; AAGCGCCGCCTAAATGAAAATAATG
>probe:Drosophila_2:1634853_at:171:575; Interrogation_Position=2967; Antisense; GGCGGACGATTTTATTGACGAGATA
>probe:Drosophila_2:1634853_at:718:213; Interrogation_Position=3009; Antisense; GAATTAAGGCTGGTACATTTCGGTA
>probe:Drosophila_2:1634853_at:252:461; Interrogation_Position=3071; Antisense; GATTTTCATTTGTTTGCTACCAATT
>probe:Drosophila_2:1634853_at:706:569; Interrogation_Position=3177; Antisense; GGCTACTTTAGCTAATTTCAATTGC
>probe:Drosophila_2:1634853_at:404:723; Interrogation_Position=3198; Antisense; TTGCAATTAACTAGCCAGAGTCTGG
>probe:Drosophila_2:1634853_at:526:3; Interrogation_Position=3277; Antisense; ATTGTGTGCGGAGCTTACCTGAAAT

Paste this into a BLAST search page for me
GGCTGTGGACGGACTTTTGTAAACAGACTTTTGTAAACAGTTCCCAGTTGTTCCCAGTTGAATGTGCATGTCCGAGTCCGAAAGATTCACGATGGCATCATGGCATCATTTTGCTCCAGGAGGATGGAGGACGAATACATCACCGATGATATCCACATCTAAAAAGCGCCGCCTAAAGCGCCGCCTAAATGAAAATAATGGGCGGACGATTTTATTGACGAGATAGAATTAAGGCTGGTACATTTCGGTAGATTTTCATTTGTTTGCTACCAATTGGCTACTTTAGCTAATTTCAATTGCTTGCAATTAACTAGCCAGAGTCTGGATTGTGTGCGGAGCTTACCTGAAAT

Full Affymetrix probeset data:

Annotations for 1634853_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720