Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634854_at:

>probe:Drosophila_2:1634854_at:523:377; Interrogation_Position=2634; Antisense; GAAGCACAGGGCTTTCTTTGCCAAC
>probe:Drosophila_2:1634854_at:265:201; Interrogation_Position=2659; Antisense; AACCGCCTGGCTGGTATCTTATTTC
>probe:Drosophila_2:1634854_at:595:133; Interrogation_Position=2686; Antisense; ACCCTGTGTCAGTTGGTGGTGCAGC
>probe:Drosophila_2:1634854_at:670:509; Interrogation_Position=2704; Antisense; GTGCAGCACGCTAACTTCAAGGTAC
>probe:Drosophila_2:1634854_at:461:223; Interrogation_Position=2722; Antisense; AAGGTACGCACCAATGCAGCCGGAG
>probe:Drosophila_2:1634854_at:99:127; Interrogation_Position=2739; Antisense; AGCCGGAGTTCTGCTGCAGGTCAAG
>probe:Drosophila_2:1634854_at:613:113; Interrogation_Position=2762; Antisense; AGCAGCGTGAGGACTTCAGTGCCCA
>probe:Drosophila_2:1634854_at:508:281; Interrogation_Position=2819; Antisense; CTCTGGTGCGCTCTAATGTATTGGA
>probe:Drosophila_2:1634854_at:35:263; Interrogation_Position=2878; Antisense; CAGCAACAGTTGTGCCTAGCCATTG
>probe:Drosophila_2:1634854_at:563:603; Interrogation_Position=2912; Antisense; TGTTGCTGGCCAGGAGCTCGGATCT
>probe:Drosophila_2:1634854_at:231:625; Interrogation_Position=2936; Antisense; TGCCGATGATGCGAGAGTCCCTAGA
>probe:Drosophila_2:1634854_at:202:11; Interrogation_Position=3006; Antisense; ATTCCGCATTGTTCCTGAGCAGTCG
>probe:Drosophila_2:1634854_at:247:205; Interrogation_Position=3145; Antisense; AAGCCTCCTGCTTTAATCTACCTAA
>probe:Drosophila_2:1634854_at:426:707; Interrogation_Position=3191; Antisense; TTAAATGTTAACTCCTCTAGCGCAA

Paste this into a BLAST search page for me
GAAGCACAGGGCTTTCTTTGCCAACAACCGCCTGGCTGGTATCTTATTTCACCCTGTGTCAGTTGGTGGTGCAGCGTGCAGCACGCTAACTTCAAGGTACAAGGTACGCACCAATGCAGCCGGAGAGCCGGAGTTCTGCTGCAGGTCAAGAGCAGCGTGAGGACTTCAGTGCCCACTCTGGTGCGCTCTAATGTATTGGACAGCAACAGTTGTGCCTAGCCATTGTGTTGCTGGCCAGGAGCTCGGATCTTGCCGATGATGCGAGAGTCCCTAGAATTCCGCATTGTTCCTGAGCAGTCGAAGCCTCCTGCTTTAATCTACCTAATTAAATGTTAACTCCTCTAGCGCAA

Full Affymetrix probeset data:

Annotations for 1634854_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime