Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634856_at:

>probe:Drosophila_2:1634856_at:284:639; Interrogation_Position=2737; Antisense; TCGGATGCCACCGTTTGTTCGACAA
>probe:Drosophila_2:1634856_at:199:603; Interrogation_Position=2752; Antisense; TGTTCGACAACCTCATCGATGGAGT
>probe:Drosophila_2:1634856_at:622:431; Interrogation_Position=2773; Antisense; GAGTCGCTTTAGTGATAGCCTTAAA
>probe:Drosophila_2:1634856_at:470:601; Interrogation_Position=2921; Antisense; TGTTTAGCTTACTCAATCTGAAGTT
>probe:Drosophila_2:1634856_at:552:19; Interrogation_Position=2955; Antisense; ATTTGGATCCCATGACTTACGTTAT
>probe:Drosophila_2:1634856_at:411:19; Interrogation_Position=2991; Antisense; ATTTGACACCTCAGTTCATTGTATA
>probe:Drosophila_2:1634856_at:509:491; Interrogation_Position=3042; Antisense; GTAAATCATCGAACGCTGCTGTGCA
>probe:Drosophila_2:1634856_at:668:381; Interrogation_Position=3052; Antisense; GAACGCTGCTGTGCAATCAATCAAT
>probe:Drosophila_2:1634856_at:137:495; Interrogation_Position=3090; Antisense; GTAATTCCAATCAATGTTGTGCCGT
>probe:Drosophila_2:1634856_at:496:467; Interrogation_Position=3105; Antisense; GTTGTGCCGTACGTTACTCTACAAA
>probe:Drosophila_2:1634856_at:691:51; Interrogation_Position=3132; Antisense; ATGCATGCCCATACCATAATACTAT
>probe:Drosophila_2:1634856_at:487:707; Interrogation_Position=3169; Antisense; TTAAGCTAACAATCGGTCAAGACTC
>probe:Drosophila_2:1634856_at:313:673; Interrogation_Position=3208; Antisense; TACCGGCTTACATATGTATCTCCAT
>probe:Drosophila_2:1634856_at:713:481; Interrogation_Position=3223; Antisense; GTATCTCCATGTCTAATCAATTTCA

Paste this into a BLAST search page for me
TCGGATGCCACCGTTTGTTCGACAATGTTCGACAACCTCATCGATGGAGTGAGTCGCTTTAGTGATAGCCTTAAATGTTTAGCTTACTCAATCTGAAGTTATTTGGATCCCATGACTTACGTTATATTTGACACCTCAGTTCATTGTATAGTAAATCATCGAACGCTGCTGTGCAGAACGCTGCTGTGCAATCAATCAATGTAATTCCAATCAATGTTGTGCCGTGTTGTGCCGTACGTTACTCTACAAAATGCATGCCCATACCATAATACTATTTAAGCTAACAATCGGTCAAGACTCTACCGGCTTACATATGTATCTCCATGTATCTCCATGTCTAATCAATTTCA

Full Affymetrix probeset data:

Annotations for 1634856_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime