Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634861_at:

>probe:Drosophila_2:1634861_at:94:381; Interrogation_Position=3429; Antisense; GAACCAAACTTACAATGATCATCTA
>probe:Drosophila_2:1634861_at:380:231; Interrogation_Position=3442; Antisense; AATGATCATCTAAAAGCCAACTCAA
>probe:Drosophila_2:1634861_at:171:311; Interrogation_Position=3457; Antisense; GCCAACTCAAATCAACTTAATTCTA
>probe:Drosophila_2:1634861_at:697:651; Interrogation_Position=3498; Antisense; TAAGTCCTTAAGAAATTTGGGCCAT
>probe:Drosophila_2:1634861_at:234:693; Interrogation_Position=3513; Antisense; TTTGGGCCATAACCATGATGACGAT
>probe:Drosophila_2:1634861_at:246:181; Interrogation_Position=3544; Antisense; AAAAAACTTCAGGAGCAGGCAAGAA
>probe:Drosophila_2:1634861_at:420:117; Interrogation_Position=3591; Antisense; AGCTAGTTTGACCTTGAGCATTCTA
>probe:Drosophila_2:1634861_at:379:13; Interrogation_Position=3655; Antisense; ATTCAAACTTCACTATACTCTCCTG
>probe:Drosophila_2:1634861_at:138:663; Interrogation_Position=3670; Antisense; TACTCTCCTGATGAGATGGATGGTT
>probe:Drosophila_2:1634861_at:458:341; Interrogation_Position=3705; Antisense; GCTATATGAGCTTAGACAGGACATT
>probe:Drosophila_2:1634861_at:43:557; Interrogation_Position=3774; Antisense; GGACGCTGTTAAACATCTCGATACA
>probe:Drosophila_2:1634861_at:553:405; Interrogation_Position=3826; Antisense; GATAAAGCTAAAACAAGTACCCTTG
>probe:Drosophila_2:1634861_at:677:155; Interrogation_Position=3852; Antisense; ACACAAGGAACTAGATATGCGGATC
>probe:Drosophila_2:1634861_at:318:153; Interrogation_Position=3950; Antisense; ACATGATGAACGATCTTATGGACCA

Paste this into a BLAST search page for me
GAACCAAACTTACAATGATCATCTAAATGATCATCTAAAAGCCAACTCAAGCCAACTCAAATCAACTTAATTCTATAAGTCCTTAAGAAATTTGGGCCATTTTGGGCCATAACCATGATGACGATAAAAAACTTCAGGAGCAGGCAAGAAAGCTAGTTTGACCTTGAGCATTCTAATTCAAACTTCACTATACTCTCCTGTACTCTCCTGATGAGATGGATGGTTGCTATATGAGCTTAGACAGGACATTGGACGCTGTTAAACATCTCGATACAGATAAAGCTAAAACAAGTACCCTTGACACAAGGAACTAGATATGCGGATCACATGATGAACGATCTTATGGACCA

Full Affymetrix probeset data:

Annotations for 1634861_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime